HUGE

Gene/Protein Characteristic Table for KIAA0107

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01960
Accession No. :	D14663
Description :	26S proteasome non-ATPase regulatory subunit 6.
HUGO Gene Name :	proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 (PSMD6)
Clone Name :	ha00588 [Vector Info]
Flexi ORF Clone :	pF1KA0107
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 1308 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 113 bp

Genome contig ID gi89161205r_63871271
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TCAGCTGTATAAAATAAATACTGCATTGTTGTTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TTTCCATTTATTTTTTTCTTAAACACATAGGCCTTCTAGAATCGGGTCCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 63971271 63984160 8 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 397 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE87141	1.1e-158	99.7	unnamed protein...	Macaca fascicularis
Q3T0B2	2.3e-157	98.5	26S proteasome ...	Bos taurus
XP_541816	3.5e-156	97.7	similar to 26S ...	Canis lupus fam...
AAH59159	4.1e-156	97.9	Proteasome (pro...	Rattus norvegicus
BAB26823	8.5e-155	97.2	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000717 262 366 PF01399 Proteasome component region PCI

HMMSmart IPR000717 298 381 SM00088 Proteasome component region PCI

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000717	262	366	PF01399	Proteasome component region PCI
HMMSmart	IPR000717	298	381	SM00088	Proteasome component region PCI

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: "4,7"

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: ACAGTCTTCCAGCAGTTCGGC
Primer_r	: CGATAATGAGGGGCAAAAAGC
PCR product length	: 127 (1.7k) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	113 bp
Genome contig ID	gi89161205r_63871271
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TCAGCTGTATAAAATAAATACTGCATTGTTGTTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTTCCATTTATTTTTTTCTTAAACACATAGGCCTTCTAGAATCGGGTCCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	63971271	63984160	8	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0107

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information