HUGE

Gene/Protein Characteristic Table for KIAA0110

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00019
Accession No. :	D14811
Description :	MAD2L1-binding protein.
HUGO Gene Name :	MAD2L1 binding protein (MAD2L1BP)
Clone Name :	ha00666 [Vector Info]
Flexi ORF Clone :	pF1KA0110
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 1233 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 405 bp

Genome contig ID gi89161210f_43611588
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TATGAACTTAAATATAAAATAAATAGATTCTTATT
Flanking genome sequence
(105067 - 105116)
----+----*----+----*----+----*----+----*----+----*
ATATTTTCCTGAAATTGTTTTGACTTAACTTGTCAGGTTTTAGGCTATTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 43711588 43716653 3 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 275 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG59665	4.8e-121	99.6	unnamed protein...	Homo sapiens
CAG33174	8.6e-121	99.6	MAD2L1BP [Homo ...	Homo sapiens
XP_518498	7e-120	98.9	MAD2L1 binding ...	Pan troglodytes
XP_001096335	1.3e-116	95.3	MAD2L1 binding ...	Macaca mulatta
NP_001003690	3.5e-115	98.9	MAD2L1 binding ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 2 275 PD125087 NULL

HMMPfam IPR009511 10 275 PF06581 MAD2L1 binding protein

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	2	275	PD125087	NULL
HMMPfam	IPR009511	10	275	PF06581	MAD2L1 binding protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: Stanford G3
Primer_f	: GCTGTGACTGTGACTGTAATC
Primer_r	: CACAGCAAAGAGCAGAAAGGG
PCR product length	: 159 bp
PCR conditions	: 95 °C15 sec64 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	405 bp
Genome contig ID	gi89161210f_43611588
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TATGAACTTAAATATAAAATAAATAGATTCTTATT
Flanking genome sequence (105067 - 105116)	----+--------+--------+--------+--------+----* ATATTTTCCTGAAATTGTTTTGACTTAACTTGTCAGGTTTTAGGCTATTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	43711588	43716653	3	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0110

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information