HUGE

Gene/Protein Characteristic Table for KIAA0116

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00021
Accession No. :	D29958
Description :	Exosome complex exonuclease RRP42.
HUGO Gene Name :	exosome component 7 (EXOSC7)
Clone Name :	ha00800 [Vector Info]
Flexi ORF Clone :	pF1KA0116
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 1011 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 137 bp

Genome contig ID gi89161205f_44892776
PolyA signal sequence
(ATTAAA,-26)
+----*----+----*----+----*----+----
ACATGTAAAATTAAAGGCTATTTTCTGGTCTGGTT
Flanking genome sequence
(135198 - 135247)
----+----*----+----*----+----*----+----*----+----*
TGGTATGTCTAGAGTTCTTCAGTTGAAGCCAAGGCACCATTCAGTGACCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 44992776 45027972 8 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 290 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q15024	2.1e-128	100.0	Exosome complex...	Homo sapiens
EAW64731	4.2e-128	99.7	exosome compone...	Homo sapiens
2NN6	4.3e-128	99.7	Structure of th...	Homo sapiens
BAG38096	7e-127	99.3	unnamed protein...	Homo sapiens
XP_533858	3.1e-126	97.2	similar to Exos...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001247 30 165 PF01138 Exoribonuclease

IPR015847 195 261 PF03725 Exoribonuclease

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001247	30	165	PF01138	Exoribonuclease
IPR015847	195	261	PF03725	Exoribonuclease

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GATGATGGAGACTGGCAAGCG
Primer_r	: TCCACAGTTGAGCAGTTGATG
PCR product length	: 142 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	137 bp
Genome contig ID	gi89161205f_44892776
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- ACATGTAAAATTAAAGGCTATTTTCTGGTCTGGTT
Flanking genome sequence (135198 - 135247)	----+--------+--------+--------+--------+----* TGGTATGTCTAGAGTTCTTCAGTTGAAGCCAAGGCACCATTCAGTGACCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	44992776	45027972	8	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0116

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information