HUGE |
Gene/Protein Characteristic Table for KIAA0118 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06560 |
---|---|
Accession No. : | D42087 |
Description : | Ras-related protein Rab-21. |
HUGO Gene Name : | RAB21, member RAS oncogene family (RAB21) |
Clone Name : | ha00793 [Vector Info] |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1413 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 927 bp Genome contig ID gi89161190f_70350638 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TTATCTGCTTTTACAAGCGCAAGGTGCAAAAATATFlanking genome sequence
(116011 - 116060) ----+----*----+----*----+----*----+----*----+----*
ATACAATAGTCTCATTGATGACTGTAAAGTGAATTAACATTTGGTGATTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 f 70449880 70466647 6 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 161 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 12 |
: Genebridge 4 | |
: TGATAGAAACAGCACAAGTGG | |
: TCCTGGCTAACCTGGTGAAAC | |
: 582 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |