HUGE |
Gene/Protein Characteristic Table for KIAA0119 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00414 |
---|---|
Accession No. : | D17793 |
Description : | Aldo-keto reductase family 1 member C3. |
HUGO Gene Name : | aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) (AKR1C3) |
Clone Name : | ha01753 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0119
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1204 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 181 bp Genome contig ID gi89161187f_5026586 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
GCCAGAAAGACAATAAATTTTTATCATTTTGAAATFlanking genome sequence
(113292 - 113341) ----+----*----+----*----+----*----+----*----+----*
AATTGAATGTTTTCTCAAAGATTCTTTACCTACTCTGTTCTGTAGTGTGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 f 5126586 5139876 9 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 325 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 10 |
: Stanford G3 | |
: AGGAGAAGCAGCAGCAAA | |
: TGCATAGGTGCCAAATCC | |
: 124 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |