HUGE

Gene/Protein Characteristic Table for KIAA0120

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00415
Accession No. :	D21261
Description :	Transgelin-2.
HUGO Gene Name :	transgelin 2 (TAGLN2)
Clone Name :	ha01756 [Vector Info]
Flexi ORF Clone :	pF1KSDA0120
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 1360 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 687 bp

Genome contig ID gi89161185r_158054527
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GTTTGTTGATTTAAATAAAGAATTTGTCATTTTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATGGACTCTGGCTGTGTCTGGGGCCACTGTGCCACTGTGGGGAAGGGAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 158154527 158161908 5 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 219 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_852741	2.2e-84	98.6	similar to tran...	Canis lupus fam...
P37802	1.9e-81	100.0	Transgelin-2; S...	Homo sapiens
AAV38421	1.9e-81	100.0	transgelin 2 [s...	synthetic construct
AAH02616	5.5e-81	99.5	Transgelin 2 [H...	Homo sapiens
Q5E9F5	1.6e-80	99.0	Transgelin-2.	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR003247 79 123 PD001527 Calponin-like actin-binding subtype

FPrintScan IPR003096 23 37 PR00888 SM22/calponin

IPR003096 42 55 PR00888 SM22/calponin

IPR001061 54 73 PR00890 Transgelin (SM22-alpha)

IPR003096 72 87 PR00888 SM22/calponin

IPR001061 82 97 PR00890 Transgelin (SM22-alpha)

IPR001061 104 117 PR00890 Transgelin (SM22-alpha)

IPR003096 108 124 PR00888 SM22/calponin

IPR003096 124 139 PR00888 SM22/calponin

IPR001061 138 147 PR00890 Transgelin (SM22-alpha)

IPR003096 145 159 PR00888 SM22/calponin

IPR001061 155 174 PR00890 Transgelin (SM22-alpha)

IPR001061 181 193 PR00890 Transgelin (SM22-alpha)

IPR003096 182 195 PR00888 SM22/calponin

IPR003096 195 210 PR00888 SM22/calponin

HMMPfam IPR001715 45 157 PF00307 Calponin-like actin-binding

IPR000557 194 219 PF00402 Calponin repeat

HMMSmart IPR001715 46 152 SM00033 Calponin-like actin-binding

ProfileScan IPR001715 44 156 PS50021 Calponin-like actin-binding

IPR000557 194 219 PS51122 Calponin repeat

ScanRegExp IPR000557 194 213 PS01052 Calponin repeat

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR003247	79	123	PD001527	Calponin-like actin-binding subtype
FPrintScan	IPR003096	23	37	PR00888	SM22/calponin
IPR003096	42	55	PR00888	SM22/calponin
IPR001061	54	73	PR00890	Transgelin (SM22-alpha)
IPR003096	72	87	PR00888	SM22/calponin
IPR001061	82	97	PR00890	Transgelin (SM22-alpha)
IPR001061	104	117	PR00890	Transgelin (SM22-alpha)
IPR003096	108	124	PR00888	SM22/calponin
IPR003096	124	139	PR00888	SM22/calponin
IPR001061	138	147	PR00890	Transgelin (SM22-alpha)
IPR003096	145	159	PR00888	SM22/calponin
IPR001061	155	174	PR00890	Transgelin (SM22-alpha)
IPR001061	181	193	PR00890	Transgelin (SM22-alpha)
IPR003096	182	195	PR00888	SM22/calponin
IPR003096	195	210	PR00888	SM22/calponin
HMMPfam	IPR001715	45	157	PF00307	Calponin-like actin-binding
IPR000557	194	219	PF00402	Calponin repeat
HMMSmart	IPR001715	46	152	SM00033	Calponin-like actin-binding
ProfileScan	IPR001715	44	156	PS50021	Calponin-like actin-binding
IPR000557	194	219	PS51122	Calponin repeat
ScanRegExp	IPR000557	194	213	PS01052	Calponin repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: Stanford G3
Primer_f	: CTCTGCCTTCTGATGCTGGAC
Primer_r	: GAAAATGAGAAGCCACGAGGG
PCR product length	: 233 (0.8k) bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	687 bp
Genome contig ID	gi89161185r_158054527
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GTTTGTTGATTTAAATAAAGAATTTGTCATTTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGGACTCTGGCTGTGTCTGGGGCCACTGTGCCACTGTGGGGAAGGGAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	158154527	158161908	5	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0120

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information