HUGE

Gene/Protein Characteristic Table for KIAA0122

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00416
Accession No. :	D50912
Description :	RNA-binding protein 10.
HUGO Gene Name :	RNA binding motif protein 10 (RBM10)
Clone Name :	ha03733 [Vector Info]
Flexi ORF Clone :	pF1KSDA0122
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3244 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 210 bp

Genome contig ID gi89161218f_46789710
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
ATCACGTCCTGTTTTGTAATAAAAGCTGAAAAGTC
Flanking genome sequence
(141444 - 141493)
----+----*----+----*----+----*----+----*----+----*
TGCATGTTGGCCTCTCCTCTTTCTCGTGCTCTAGCACAGTTGTATAGCCT

Features of the protein sequence	Description

Length: 1010 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW59286	99.6	RNA binding mot...	Homo sapiens
CAD97933	99.5	hypothetical pr...	Homo sapiens
BAG09612	100.0	RNA binding mot...	synthetic construct
EAW59283	99.9	RNA binding mot...	Homo sapiens
P98175	99.8	RNA-binding pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000504 212 277 PF00076 RNA recognition motif

IPR001876 293 323 PF00641 Zinc finger

IPR000504 383 459 PF00076 RNA recognition motif

IPR000467 938 982 PF01585 D111/G-patch

HMMSmart IPR000504 211 286 SM00360 RNA recognition motif

IPR001876 296 320 SM00547 Zinc finger

IPR000504 382 460 SM00360 RNA recognition motif

IPR000467 936 982 SM00443 D111/G-patch

ProfileScan IPR000504 210 290 PS50102 RNA recognition motif

IPR001876 293 323 PS50199 Zinc finger

IPR000504 381 464 PS50102 RNA recognition motif

IPR007087 839 869 PS50157 Zinc finger

IPR000467 938 984 PS50174 D111/G-patch

ScanRegExp IPR001876 298 317 PS01358 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	212	277	PF00076	RNA recognition motif
IPR001876	293	323	PF00641	Zinc finger
IPR000504	383	459	PF00076	RNA recognition motif
IPR000467	938	982	PF01585	D111/G-patch
HMMSmart	IPR000504	211	286	SM00360	RNA recognition motif
IPR001876	296	320	SM00547	Zinc finger
IPR000504	382	460	SM00360	RNA recognition motif
IPR000467	936	982	SM00443	D111/G-patch
ProfileScan	IPR000504	210	290	PS50102	RNA recognition motif
IPR001876	293	323	PS50199	Zinc finger
IPR000504	381	464	PS50102	RNA recognition motif
IPR007087	839	869	PS50157	Zinc finger
IPR000467	938	984	PS50174	D111/G-patch
ScanRegExp	IPR001876	298	317	PS01358	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GAGCCCACTTGTCAGAAAACG
Primer_r	: ACTTCCTCCTCTTGGGCTCTG
PCR product length	: 135 (0.4k) bp
PCR conditions	: 95 °C15 sec70 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	210 bp
Genome contig ID	gi89161218f_46789710
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATCACGTCCTGTTTTGTAATAAAAGCTGAAAAGTC
Flanking genome sequence (141444 - 141493)	----+--------+--------+--------+--------+----* TGCATGTTGGCCTCTCCTCTTTCTCGTGCTCTAGCACAGTTGTATAGCCT

Gene/Protein Characteristic Table for KIAA0122

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information