HUGE |
Gene/Protein Characteristic Table for KIAA0123 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07716 |
---|---|
Accession No. : | D50913 |
Description : | Mitochondrial-processing peptidase alpha subunit, mitochondrial precursor. |
HUGO Gene Name : | peptidase (mitochondrial processing) alpha (PMPCA) |
Clone Name : | ha01523s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0123
![]() |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced ha01523, former representative clones for KIAA0123 with ha01523s1. (2008/8/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2083 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 496 bp Genome contig ID gi89161216f_138324933 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
AGCTTCCCTGGTAATAAAGAGCTGGCATCTTTCTTFlanking genome sequence
(113102 - 113151) ----+----*----+----*----+----*----+----*----+----*
AGCACGGTGTTTTCCTTCTCGCCTGGGGAGGGGCGGTTCTTAAGGGCTGT
Features of the protein sequence |
Description | |
---|---|---|
Length: 528 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR011765 | 80 | 230 | PF00675 | Peptidase M16 |
IPR007863 | 235 | 434 | PF05193 | Peptidase M16 | |
ScanRegExp | IPR001431 | 100 | 123 | PS00143 | Peptidase M16 |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 4 |
: Stanford G3 | |
: TTCCCGTGCGTGTTAGTTTGG | |
: TTCACCTGCTTCCTGGCTTGC | |
: 279 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |