HUGE |
Gene/Protein Characteristic Table for KIAA0125 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05583 |
---|---|
Accession No. : | D50915 |
Description : | |
HUGO Gene Name : | |
Clone Name : | ha00502 [Vector Info] |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7883 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 7089 bp Genome contig ID gi51511730f_105361657 PolyA signal sequence
(ATTAAA,-16) +----*----+----*----+----*----+----
AACAGTCTATTTGCTTTACATTAAATTTGTAGGCTFlanking genome sequence
(107890 - 107939) ----+----*----+----*----+----*----+----*----+----*
AATTTGTGTACCTTCAGAGTGTGAAAGTTTTCTCCTGAGGAAAATGGGGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 f 105461657 105469545 1 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 109 aa
No significant homologues
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 14 |
: Genebridge 4 | |
: AGGATGTGAAAAGGCAGGAAC | |
: ACAAAATACCCAGCATCGCCC | |
: 191 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |