HUGE

Gene/Protein Characteristic Table for KIAA0125

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05583
Accession No. :	D50915
Description :
HUGO Gene Name :
Clone Name :	ha00502 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 7883 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 7089 bp

Genome contig ID gi51511730f_105361657
PolyA signal sequence
(ATTAAA,-16)
+----*----+----*----+----*----+----
AACAGTCTATTTGCTTTACATTAAATTTGTAGGCT
Flanking genome sequence
(107890 - 107939)
----+----*----+----*----+----*----+----*----+----*
AATTTGTGTACCTTCAGAGTGTGAAAGTTTTCTCCTGAGGAAAATGGGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 105461657 105469545 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 109 aa
Result of homology search against nr database (FASTA output)
No significant homologues
Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: AGGATGTGAAAAGGCAGGAAC
Primer_r	: ACAAAATACCCAGCATCGCCC
PCR product length	: 191 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	7089 bp
Genome contig ID	gi51511730f_105361657
PolyA signal sequence (ATTAAA,-16)	+--------+--------+----*----+---- AACAGTCTATTTGCTTTACATTAAATTTGTAGGCT
Flanking genome sequence (107890 - 107939)	----+--------+--------+--------+--------+----* AATTTGTGTACCTTCAGAGTGTGAAAGTTTTCTCCTGAGGAAAATGGGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	105461657	105469545	1	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0125

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information