HUGE

Gene/Protein Characteristic Table for KIAA0129

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07197
Accession No. :	D50919
Description :	Tripartite motif-containing protein 14.
HUGO Gene Name :	tripartite motif-containing 14 (TRIM14)
Clone Name :	ha00496 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4454 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3115 bp

Genome contig ID gi89161216r_99786458
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
ATTTGGTTTAATAAAATGTGAATAATGTCCCTTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACCATGGTCTTCACTGGGAGTTCATGTTGCTTCAAGTCCCTAGCACCCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 99886458 99921301 6 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 442 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q14142	2.7e-183	100.0	Tripartite moti...	Homo sapiens
EAW58875	2.5e-181	99.3	tripartite moti...	Homo sapiens
XP_520143	1.8e-179	97.3	tripartite moti...	Pan troglodytes
XP_001113460	1.5e-175	95.0	similar to trip...	Macaca mulatta
Q8BVW3	3e-140	77.4	Tripartite moti...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000315 33 50 PR01406 Zinc finger

IPR000315 52 66 PR01406 Zinc finger

IPR003879 265 282 PR01407 Butyrophylin-like

IPR003879 304 328 PR01407 Butyrophylin-like

IPR003879 335 348 PR01407 Butyrophylin-like

IPR003879 382 406 PR01407 Butyrophylin-like

IPR003879 413 431 PR01407 Butyrophylin-like

HMMPfam IPR000315 19 61 PF00643 Zinc finger

IPR003877 319 440 PF00622 SPla/RYanodine receptor SPRY

HMMSmart IPR000315 19 61 SM00336 Zinc finger

IPR006574 266 318 SM00589 SPRY-associated

IPR003877 319 442 SM00449 SPla/RYanodine receptor SPRY

ProfileScan IPR000315 24 58 PS50119 Zinc finger

IPR001870 249 442 PS50188 B302

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000315	33	50	PR01406	Zinc finger
IPR000315	52	66	PR01406	Zinc finger
IPR003879	265	282	PR01407	Butyrophylin-like
IPR003879	304	328	PR01407	Butyrophylin-like
IPR003879	335	348	PR01407	Butyrophylin-like
IPR003879	382	406	PR01407	Butyrophylin-like
IPR003879	413	431	PR01407	Butyrophylin-like
HMMPfam	IPR000315	19	61	PF00643	Zinc finger
IPR003877	319	440	PF00622	SPla/RYanodine receptor SPRY
HMMSmart	IPR000315	19	61	SM00336	Zinc finger
IPR006574	266	318	SM00589	SPRY-associated
IPR003877	319	442	SM00449	SPla/RYanodine receptor SPRY
ProfileScan	IPR000315	24	58	PS50119	Zinc finger
IPR001870	249	442	PS50188	B302

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: Stanford G3
Primer_f	: AGAATACCAGGCAGACAGAAC
Primer_r	: AGGGATGGGCAGAAATGTTGG
PCR product length	: 220 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3115 bp
Genome contig ID	gi89161216r_99786458
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- ATTTGGTTTAATAAAATGTGAATAATGTCCCTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCATGGTCTTCACTGGGAGTTCATGTTGCTTCAAGTCCCTAGCACCCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	99886458	99921301	6	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA0129

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information