HUGE |
Gene/Protein Characteristic Table for KIAA0129 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07197 |
---|---|
Accession No. : | D50919 |
Description : | Tripartite motif-containing protein 14. |
HUGO Gene Name : | tripartite motif-containing 14 (TRIM14) |
Clone Name : | ha00496 [Vector Info] |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4454 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3115 bp Genome contig ID gi89161216r_99786458 PolyA signal sequence
(AATAAA,-26) +----*----+----*----+----*----+----
ATTTGGTTTAATAAAATGTGAATAATGTCCCTTTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AACCATGGTCTTCACTGGGAGTTCATGTTGCTTCAAGTCCCTAGCACCCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 r 99886458 99921301 6 99.1 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 442 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 9 |
: Stanford G3 | |
: AGAATACCAGGCAGACAGAAC | |
: AGGGATGGGCAGAAATGTTGG | |
: 220 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |