HUGE

Gene/Protein Characteristic Table for KIAA0133

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07735
Accession No. :	D50923
Description :
HUGO Gene Name :
Clone Name :	ha03502s1 [Vector Info]
Flexi ORF Clone :	pF1KA0133
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha03502, former representative clones for KIAA0133 with ha03502s1. (2008/8/27)

Features of the cloned DNA sequence	Description

Length: 5613 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 902 bp

Genome contig ID gi89161185f_227728604
PolyA signal sequence
(CATAAA,-23)
+----*----+----*----+----*----+----
GCTAAATTGGATCATAAATGCATTTTTTTAAAGTT
Flanking genome sequence
(133967 - 134016)
----+----*----+----*----+----*----+----*----+----*
ACCTTTTTTCCTGTGTAATATTTTAAGTAACTCTGGGTCAGTGAAAACAT

Features of the protein sequence	Description

Length: 1527 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF83702	99.8	unnamed protein...	Homo sapiens
XP_001083545	93.5	hypothetical pr...	Macaca mulatta
AAI48097	73.7	LOC514623 prote...	Bos taurus
NP_001025047	71.5	URB2 ribosome b...	Mus musculus
EDL11764	70.0	cDNA sequence A...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: Stanford G3
Primer_f	: TGCCTGCTCCTCCTGTGTTAG
Primer_r	: AAGATACTCCAAGGTGACAAC
PCR product length	: 214 bp
PCR conditions	: 95 °C15 sec62 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	902 bp
Genome contig ID	gi89161185f_227728604
PolyA signal sequence (CATAAA,-23)	+--------+--------+----*----+---- GCTAAATTGGATCATAAATGCATTTTTTTAAAGTT
Flanking genome sequence (133967 - 134016)	----+--------+--------+--------+--------+----* ACCTTTTTTCCTGTGTAATATTTTAAGTAACTCTGGGTCAGTGAAAACAT

Gene/Protein Characteristic Table for KIAA0133

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information