HUGE |
Gene/Protein Characteristic Table for KIAA0133 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07735 |
---|---|
Accession No. : | D50923 |
Description : | |
HUGO Gene Name : | |
Clone Name : | ha03502s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0133
![]() |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced ha03502, former representative clones for KIAA0133 with ha03502s1. (2008/8/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5613 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 902 bp Genome contig ID gi89161185f_227728604 PolyA signal sequence
(CATAAA,-23) +----*----+----*----+----*----+----
GCTAAATTGGATCATAAATGCATTTTTTTAAAGTTFlanking genome sequence
(133967 - 134016) ----+----*----+----*----+----*----+----*----+----*
ACCTTTTTTCCTGTGTAATATTTTAAGTAACTCTGGGTCAGTGAAAACAT
Features of the protein sequence |
Description | |
---|---|---|
Length: 1527 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 1 |
: Stanford G3 | |
: TGCCTGCTCCTCCTGTGTTAG | |
: AAGATACTCCAAGGTGACAAC | |
: 214 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |