HUGE

Gene/Protein Characteristic Table for KIAA0138

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01961
Accession No. :	D50928
Description :	Scaffold attachment factor B2.
HUGO Gene Name :	scaffold attachment factor B2 (SAFB2)
Clone Name :	ha03743 [Vector Info]
Flexi ORF Clone :	pF1KA0138
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3233 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 335 bp

Genome contig ID gi42406306r_5438011
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CATTCCATTTTCCATTAATAAAGTTTACCATTCGC
Flanking genome sequence
(235752 - 235703)
----+----*----+----*----+----*----+----*----+----*
CCGGGGTTGCGGGGGGGGGGGTCTTGATAAACCACCGTTTGCTGGGTCCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 5538010 5573762 21 99.9 Terminal No-hit

Features of the protein sequence	Description

Length: 962 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_512297	0	99.7	scaffold attach...	Pan troglodytes
XP_001084042	0	98.6	scaffold attach...	Macaca mulatta
XP_533945	0	88.9	similar to Scaf...	Canis lupus fam...
XP_585928	5.7e-216	82.9	similar to Scaf...	Bos taurus
EAW69165	2e-215	99.1	scaffold attach...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003034 39 73 PF02037 DNA-binding SAP

IPR000504 418 489 PF00076 RNA recognition motif

HMMSmart IPR003034 39 73 SM00513 DNA-binding SAP

IPR000504 417 490 SM00360 RNA recognition motif

ProfileScan IPR003034 39 73 PS50800 DNA-binding SAP

IPR000504 416 494 PS50102 RNA recognition motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003034	39	73	PF02037	DNA-binding SAP
IPR000504	418	489	PF00076	RNA recognition motif
HMMSmart	IPR003034	39	73	SM00513	DNA-binding SAP
IPR000504	417	490	SM00360	RNA recognition motif
ProfileScan	IPR003034	39	73	PS50800	DNA-binding SAP
IPR000504	416	494	PS50102	RNA recognition motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: AAGACGGGAACGCGACGATGG
Primer_r	: GTCCAGGTTCCGCTTCTTCAG
PCR product length	: 161 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	335 bp
Genome contig ID	gi42406306r_5438011
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CATTCCATTTTCCATTAATAAAGTTTACCATTCGC
Flanking genome sequence (235752 - 235703)	----+--------+--------+--------+--------+----* CCGGGGTTGCGGGGGGGGGGGTCTTGATAAACCACCGTTTGCTGGGTCCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	5538010	5573762	21	99.9	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0138

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information