HUGE

Gene/Protein Characteristic Table for KIAA0157

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00435
Accession No. :	D63877
Description :
HUGO Gene Name :
Clone Name :	ha03221 [Vector Info]
Flexi ORF Clone :	pF1KSDA0157
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 2957 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1695 bp

Genome contig ID gi89161187f_126380375
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
GTTAAATGTGACAATAAAAAACTTATTTAATCATG
Flanking genome sequence
(134853 - 134902)
----+----*----+----*----+----*----+----*----+----*
GTACCATTGTTTTAATGTCTGTCTCAGCACCGGACAAGGCCTTGCCTCAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 126480375 126515226 9 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 419 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001083977	6.4e-145	98.8	hypothetical pr...	Macaca mulatta
BAG59274	3.8e-144	99.3	unnamed protein...	Homo sapiens
XP_535051	8.8e-139	95.2	hypothetical pr...	Canis lupus fam...
EDL17753	1.7e-135	93.1	RIKEN cDNA C430...	Mus musculus
XP_587356	3.7e-135	93.3	hypothetical pr...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: ACCACTAAGACATTCAGGAGC
Primer_r	: AAGACAGACCCCCATAGAGTG
PCR product length	: 314 bp
PCR conditions	: 95 °C15 sec62 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1695 bp
Genome contig ID	gi89161187f_126380375
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GTTAAATGTGACAATAAAAAACTTATTTAATCATG
Flanking genome sequence (134853 - 134902)	----+--------+--------+--------+--------+----* GTACCATTGTTTTAATGTCTGTCTCAGCACCGGACAAGGCCTTGCCTCAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	126480375	126515226	9	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA0157

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information