HUGE |
Gene/Protein Characteristic Table for KIAA0163 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00438 |
---|---|
Accession No. : | D79985 |
Description : | Integral membrane protein DGCR2/IDD precursor. |
HUGO Gene Name : | DiGeorge syndrome critical region gene 2 (DGCR2) |
Clone Name : | ha01059 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0163 |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4436 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2598 bp Genome contig ID gi89161203r_17303801 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TCATCCAAATGCCAAATAAACTTGTGTTCCGGGAGFlanking genome sequence
(99997 - 99948) ----+----*----+----*----+----*----+----*----+----*
AGGCATGGTTAGTCCTTGGTGTGGCCCCCACGGCTGCCACAGGCTAAGGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 r 17403798 17489904 11 99.2 Internal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 550 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 22 |
: Stanford G3 | |
: GACTCGCTCATCTGTTCTTGC | |
: CAGTATCAAATCCCACCTCCG | |
: 205 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |