HUGE

Gene/Protein Characteristic Table for KIAA0168

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00440
Accession No. :	D79990
Description :	Ras association domain-containing protein 2.
HUGO Gene Name :	Ras association (RalGDS/AF-6) domain family member 2 (RASSF2)
Clone Name :	ha02316 [Vector Info]
Flexi ORF Clone :	pF1KSDA0168
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5426 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4249 bp

Genome contig ID gi51511747r_4608670
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TTAGATCTTACTGAAATAAAGCACTTTTCAAAGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGTGCCCCGTGGATGGGTCTGTGTGTGACTGCTGGCTGCGGGAGCTCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 4708670 4752291 12 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 331 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P50749	1.5e-127	100.0	Ras association...	Homo sapiens
XP_001164287	1.8e-127	99.7	Ras association...	Pan troglodytes
BAD96370	1.4e-126	99.4	Ras association...	Homo sapiens
XP_542904	6.5e-123	95.7	similar to Ras ...	Canis lupus fam...
XP_001925229	1.8e-122	96.0	similar to Ras ...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000159 181 269 PF00788 Ras-association

HMMSmart IPR000159 179 270 SM00314 Ras-association

ProfileScan IPR000159 181 269 PS50200 Ras-association

IPR011524 277 324 PS50951 SARAH

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000159	181	269	PF00788	Ras-association
HMMSmart	IPR000159	179	270	SM00314	Ras-association
ProfileScan	IPR000159	181	269	PS50200	Ras-association
IPR011524	277	324	PS50951	SARAH

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: Stanford G3
Primer_f	: ATAGCAGCACACATTTTCACG
Primer_r	: TACACACCAGAAACATCAGCC
PCR product length	: 303 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4249 bp
Genome contig ID	gi51511747r_4608670
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTAGATCTTACTGAAATAAAGCACTTTTCAAAGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTGCCCCGTGGATGGGTCTGTGTGTGACTGCTGGCTGCGGGAGCTCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	4708670	4752291	12	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0168

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information