HUGE

Gene/Protein Characteristic Table for KIAA0179

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01056
Accession No. :	D80001
Description :	RRP1-like protein B.
HUGO Gene Name :
Clone Name :	ha02738 [Vector Info]
Flexi ORF Clone :	pF1KA0179
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4994 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2705 bp

Genome contig ID gi51511750f_43803908
PolyA signal sequence
(ATTAAA,-27)
+----*----+----*----+----*----+----
CAAGTCCAATTAAAAAAAAAAAGTCTTTGCCCTCC
Flanking genome sequence
(136480 - 136529)
----+----*----+----*----+----*----+----*----+----*
AATTTGTGTTTGATGTTGACTTTCAGTATGGGTAAAAATAGGCCTCTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 21 f 43903908 43940386 16 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 762 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG11148	0	100.0	RRP1-like prote...	synthetic construct
Q14684	0	97.6	Ribosomal RNA p...	Homo sapiens
XP_001144331	0	96.8	hypothetical pr...	Pan troglodytes
XP_001144086	1.8e-208	92.5	hypothetical pr...	Pan troglodytes
XP_001104749	2.8e-195	85.2	hypothetical pr...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010301 30 224 PF05997 Nucleolar

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010301	30	224	PF05997	Nucleolar

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 21

Experimental conditions

Panel name	: Stanford G3
Primer_f	: GTTGCAGGTGTTGGGAGGAAG
Primer_r	: ATTGGACTTGGCTTTGACGAG
PCR product length	: 158 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2705 bp
Genome contig ID	gi51511750f_43803908
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- CAAGTCCAATTAAAAAAAAAAAGTCTTTGCCCTCC
Flanking genome sequence (136480 - 136529)	----+--------+--------+--------+--------+----* AATTTGTGTTTGATGTTGACTTTCAGTATGGGTAAAAATAGGCCTCTTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	21	f	43903908	43940386	16	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0179

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information