HUGE |
Gene/Protein Characteristic Table for KIAA0179 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01056 |
---|---|
Accession No. : | D80001 |
Description : | RRP1-like protein B. |
HUGO Gene Name : | |
Clone Name : | ha02738 [Vector Info] |
Flexi ORF Clone : | pF1KA0179
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4994 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2705 bp Genome contig ID gi51511750f_43803908 PolyA signal sequence
(ATTAAA,-27) +----*----+----*----+----*----+----
CAAGTCCAATTAAAAAAAAAAAGTCTTTGCCCTCCFlanking genome sequence
(136480 - 136529) ----+----*----+----*----+----*----+----*----+----*
AATTTGTGTTTGATGTTGACTTTCAGTATGGGTAAAAATAGGCCTCTTTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 21 f 43903908 43940386 16 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 762 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 21 |
: Stanford G3 | |
: GTTGCAGGTGTTGGGAGGAAG | |
: ATTGGACTTGGCTTTGACGAG | |
: 158 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |