HUGE

Gene/Protein Characteristic Table for KIAA0181

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00447
Accession No. :	D80003
Description :	Nuclear receptor coactivator 6.
HUGO Gene Name :	nuclear receptor coactivator 6 (NCOA6)
Clone Name :	ha02522s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0181
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha02522, former representative clones for KIAA0181 with ha02522s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6813 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 484 bp

Genome contig ID gi51511747r_32666300
PolyA signal sequence
(AATAAA,-32)
+----*----+----*----+----*----+----
GTGAATAAAGAGAATCTAAGGATTTGTACAATGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATAACGTGTTAAATAAATGTCATTGTCATAGAACATAAAGTTATGTTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 32766300 32844001 14 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 2079 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAF13595	100.0	cancer-amplifie...	Homo sapiens
Q14686	100.0	Nuclear recepto...	Homo sapiens
XP_001160316	99.3	nuclear recepto...	Pan troglodytes
XP_001103488	98.5	similar to nucl...	Macaca mulatta
AAF16403	99.9	transcriptional...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058722	0.00029	25.2	KIAA1819
AB058719	0.001	25.1	KIAA1816

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

None - - - - -

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 2 FLIVLLAYASGIIFTMVLDDLPN 24 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	2	FLIVLLAYASGIIFTMVLDDLPN	24	PRIMARY	23

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TTTCACATTTCCTAAGCAGCC
Primer_r	: TTGCTTTTGCCCCCACTACTG
PCR product length	: 110 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	484 bp
Genome contig ID	gi51511747r_32666300
PolyA signal sequence (AATAAA,-32)	+--------+--------+----*----+---- GTGAATAAAGAGAATCTAAGGATTTGTACAATGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATAACGTGTTAAATAAATGTCATTGTCATAGAACATAAAGTTATGTTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	32766300	32844001	14	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0181

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information