| HUGE |
Gene/Protein Characteristic Table for KIAA0185 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00034 |
|---|---|
| Accession No. : | D80007 |
| Description : | RRP5 protein homolog. |
| HUGO Gene Name : | programmed cell death 11 (PDCD11) |
| Clone Name : | ha02717 [Vector Info] |
| Flexi ORF Clone : | pF1KA0185
|
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5823 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 167 bp Genome contig ID gi89161187f_105048162 PolyA signal sequence
(None)
ATCCTGTCAGGATGAAAAGGAAGTTGAGATTTTTTFlanking genome sequence
(147303 - 147352)
AAATCCCTCTTCGCTTGCTTTATTTTCAGTACCAACTTGTTATCTTTTTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 f 105146449 105195463 36 100.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1884 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 10 |
| : Genebridge 4 | |
| : CATTTTTGAGAACACGCTGAG | |
| : TTCTCGTAGTCCAGGTAGCGC | |
| : 183 (1.0k) bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
