HUGE |
Gene/Protein Characteristic Table for KIAA0193 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00450 |
---|---|
Accession No. : | D83777 |
Description : | Secernin-1. |
HUGO Gene Name : | secernin 1 (SCRN1) |
Clone Name : | bh00167 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0193
![]() |
Source : | Human adult brain |
Note : | We replaced ha02308, former representative clones for KIAA0193 with bh00167. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5203 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 3844 bp Genome contig ID gi89161213r_29826268 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
AATGCATCAAGCATACAATAAAAAAAACTGAAATTFlanking genome sequence
(99984 - 99935) ----+----*----+----*----+----*----+----*----+----*
AACATCCAGTGGAGTGGCCTCTTCTGTTTTGTGTCTCGTGAATAAACGTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 r 29926252 29995895 8 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 443 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 7 |
: Genebridge 4 | |
: TGTCATTTATTGGGGAAGGTC | |
: GACTGTGCAGAATGAAAAGCC | |
: 188 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |