HUGE

Gene/Protein Characteristic Table for KIAA0194

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06906
Accession No. :	D83778
Description :	SMF protein (Fragment).
HUGO Gene Name :	HMG box domain containing 3 (HMGX3)
Clone Name :	ha02703 [Vector Info]
Flexi ORF Clone :	pF1KSDA0194
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5245 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 935 bp

Genome contig ID gi51511721f_149260507
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
CCTCTTCCCCCAACAAGAATAAAGTTTATTAAATT
Flanking genome sequence
(152378 - 152427)
----+----*----+----*----+----*----+----*----+----*
ATCTGGTTTTGGTGTAGCAGGAGTCAATTCCGTGCACATCGTATGGGGCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 149360507 149412883 20 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1435 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001714782	100.0	similar to Prot...	Homo sapiens
Q12766	99.9	Protein SMF.	Homo sapiens
XP_001717254	99.9	hypothetical pr...	Homo sapiens
BAG09647	100.0	SMF protein [sy...	synthetic construct
EAW61752	99.9	hCG38618 [Homo ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000910 185 243 PF00505 HMG1/2 (high mobility group) box

HMMSmart IPR000910 184 254 SM00398 HMG1/2 (high mobility group) box

ProfileScan IPR000910 185 243 PS50118 HMG1/2 (high mobility group) box

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000910	185	243	PF00505	HMG1/2 (high mobility group) box
HMMSmart	IPR000910	184	254	SM00398	HMG1/2 (high mobility group) box
ProfileScan	IPR000910	185	243	PS50118	HMG1/2 (high mobility group) box

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CATTTGGGGGAAGCTGAGGAG
Primer_r	: TTTCCTTATGGCCCAGTCTGC
PCR product length	: 250 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	935 bp
Genome contig ID	gi51511721f_149260507
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CCTCTTCCCCCAACAAGAATAAAGTTTATTAAATT
Flanking genome sequence (152378 - 152427)	----+--------+--------+--------+--------+----* ATCTGGTTTTGGTGTAGCAGGAGTCAATTCCGTGCACATCGTATGGGGCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	149360507	149412883	20	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0194

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information