HUGE |
Gene/Protein Characteristic Table for KIAA0195 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00451 |
---|---|
Accession No. : | D83779 |
Description : | |
HUGO Gene Name : | |
Clone Name : | ha02752 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0195 |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5022 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 748 bp Genome contig ID gi51511734f_70864331 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
TGTAGACTGGTTTGTATTAAAATGTGTCAATTGCTFlanking genome sequence
(143429 - 143478) ----+----*----+----*----+----*----+----*----+----*
AAGAAATACCTGTGGCTGGTCTGTAAGGCCACTCCAGGGTCTGCCCACCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 f 70964331 71007758 32 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1410 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 17 |
: Stanford G3 | |
: GTCTCCCGCCTGAACCTGAAG | |
: AGATTCCCCAAGACTGACAGG | |
: 102 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |