HUGE

Gene/Protein Characteristic Table for KIAA0200

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00454
Accession No. :	D83785
Description :	Mastermind-like protein 1.
HUGO Gene Name :	mastermind-like 1 (Drosophila) (MAML1)
Clone Name :	ha02508 [Vector Info]
Flexi ORF Clone :	pF1KSDA0200
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5713 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2399 bp

Genome contig ID gi51511721f_178992457
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GTTTTATCATTATAAAAATAAAGTATTTTGCTAGT
Flanking genome sequence
(144428 - 144477)
----+----*----+----*----+----*----+----*----+----*
ATGGAAACAACCTTTGTATTTGACGTCACCTGGGGTCTGCTGGCAGAAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 179092457 179136883 5 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1042 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_527150	98.3	mastermind-like...	Pan troglodytes
Q92585	100.0	Mastermind-like...	Homo sapiens
XP_001105097	96.9	mastermind-like...	Macaca mulatta
AAF34658	99.9	Mam1 [Homo sapi...	Homo sapiens
Q6T264	86.5	Mastermind-like...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058719	2.9e-20	35.5	KIAA1816
AB058722	6e-09	26.6	KIAA1819

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: Stanford G3
Primer_f	: AGAAGAAAAGGGTGCTCAGAC
Primer_r	: GGGCAGTAGAAGAATATGGGG
PCR product length	: 264 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2399 bp
Genome contig ID	gi51511721f_178992457
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GTTTTATCATTATAAAAATAAAGTATTTTGCTAGT
Flanking genome sequence (144428 - 144477)	----+--------+--------+--------+--------+----* ATGGAAACAACCTTTGTATTTGACGTCACCTGGGGTCTGCTGGCAGAAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	179092457	179136883	5	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0200

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information