HUGE

Gene/Protein Characteristic Table for KIAA0201

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00455
Accession No. :	D86956
Description :	Heat-shock protein 105 kDa.
HUGO Gene Name :	heat shock 105kDa/110kDa protein 1 (HSPH1)
Clone Name :	ha03256 [Vector Info]
Flexi ORF Clone :	pF1KSDA0201
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3614 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 690 bp

Genome contig ID gi51511729r_30508765
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
CTTTAAAATAAAGTTCATCTTATGGTGTCATTTCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACTGTTGATTTTGTCACTAATTTAAAAAATGAGATGAGGGAGAATATG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 r 30608765 30634066 18 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 949 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001142849	99.7	heat shock 105k...	Pan troglodytes
AAC18044	100.0	antigen NY-CO-2...	Homo sapiens
Q92598	100.0	Heat shock prot...	Homo sapiens
Q5R606	99.9	Heat shock prot...	Pongo abelii
XP_001493567	96.4	similar to heat...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR013126 202 255 PD000089 Heat shock protein 70

FPrintScan IPR001023 93 106 PR00301 Heat shock protein Hsp70

IPR001023 121 133 PR00301 Heat shock protein Hsp70

IPR001023 143 151 PR00301 Heat shock protein Hsp70

IPR001023 231 251 PR00301 Heat shock protein Hsp70

IPR001023 426 442 PR00301 Heat shock protein Hsp70

IPR001023 457 477 PR00301 Heat shock protein Hsp70

HMMPfam IPR013126 94 799 PF00012 Heat shock protein 70

ScanRegExp IPR013126 429 443 PS01036 Heat shock protein 70

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR013126	202	255	PD000089	Heat shock protein 70
FPrintScan	IPR001023	93	106	PR00301	Heat shock protein Hsp70
IPR001023	121	133	PR00301	Heat shock protein Hsp70
IPR001023	143	151	PR00301	Heat shock protein Hsp70
IPR001023	231	251	PR00301	Heat shock protein Hsp70
IPR001023	426	442	PR00301	Heat shock protein Hsp70
IPR001023	457	477	PR00301	Heat shock protein Hsp70
HMMPfam	IPR013126	94	799	PF00012	Heat shock protein 70
ScanRegExp	IPR013126	429	443	PS01036	Heat shock protein 70

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: ATGGACTTGGACTAGATAACC
Primer_r	: AGTTACCAAGGCAATTTTCCC
PCR product length	: 210 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	690 bp
Genome contig ID	gi51511729r_30508765
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- CTTTAAAATAAAGTTCATCTTATGGTGTCATTTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTGTTGATTTTGTCACTAATTTAAAAAATGAGATGAGGGAGAATATG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	r	30608765	30634066	18	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0201

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information