HUGE

Gene/Protein Characteristic Table for KIAA0218

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00465
Accession No. :	D86972
Description :	TatD DNase domain-containing deoxyribonuclease 2.
HUGO Gene Name :	TatD DNase domain containing 2 (TATDN2)
Clone Name :	ha02987 [Vector Info]
Flexi ORF Clone :	pF1KSDA0218
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4689 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2005 bp

Genome contig ID gi89161205f_10165219
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
CTTTTTCTGAAAATAAAGTGATGGATCCTCTAGCC
Flanking genome sequence
(132683 - 132732)
----+----*----+----*----+----*----+----*----+----*
AACCCAGTCTCTCCGTGTTTGTATAGACTTACCTGAGTGATGCAGTGGTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 10265219 10297900 9 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 777 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09663	100.0	TatD DNase doma...	synthetic construct
Q93075	99.9	Putative deoxyr...	Homo sapiens
AAH90935	99.7	TatD DNase doma...	Homo sapiens
BAF82483	99.5	unnamed protein...	Homo sapiens
XP_516276	98.7	TatD DNase doma...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001130 509 776 PF01026 TatD-related deoxyribonuclease

ScanRegExp IPR001130 511 519 PS01137 TatD-related deoxyribonuclease

IPR001130 642 652 PS01090 TatD-related deoxyribonuclease

IPR001130 709 725 PS01091 TatD-related deoxyribonuclease

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001130	509	776	PF01026	TatD-related deoxyribonuclease
ScanRegExp	IPR001130	511	519	PS01137	TatD-related deoxyribonuclease
IPR001130	642	652	PS01090	TatD-related deoxyribonuclease
IPR001130	709	725	PS01091	TatD-related deoxyribonuclease

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: AGTCTCCAAGCCTGTGCCATC
Primer_r	: AGAGGCATTCCCACAGCACAG
PCR product length	: 199 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2005 bp
Genome contig ID	gi89161205f_10165219
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CTTTTTCTGAAAATAAAGTGATGGATCCTCTAGCC
Flanking genome sequence (132683 - 132732)	----+--------+--------+--------+--------+----* AACCCAGTCTCTCCGTGTTTGTATAGACTTACCTGAGTGATGCAGTGGTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	10265219	10297900	9	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0218

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information