HUGE |
Gene/Protein Characteristic Table for KIAA0241 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05586 |
---|---|
Accession No. : | D87682 |
Description : | K0241_HUMAN Isoform 2 of Q8NBF6 - Homo sapiens. |
HUGO Gene Name : | |
Clone Name : | ha04847 [Vector Info] |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6371 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4802 bp Genome contig ID gi89161213f_32450829 PolyA signal sequence
(AATAAA,-26) +----*----+----*----+----*----+----
ATAAATGAGAATAAAATGATCCTGTTCACCCTGCCFlanking genome sequence
(144021 - 144070) ----+----*----+----*----+----*----+----*----+----*
TACAGTTGGACTTGACCTGTCCTAGAAGTACCCTGTGTGTTGTCCATGTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 f 32550824 32594848 12 99.1 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 522 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 7 |
: Genebridge 4 | |
: GTGAAGGCATTTAGTGGTTAC | |
: TACCAGAGCAAAGAGAACTAC | |
: 165 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |