HUGE

Gene/Protein Characteristic Table for KIAA0251

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00478
Accession No. :	D87438
Description :	pyridoxal-dependent decarboxylase domain containing 1.
HUGO Gene Name :	pyridoxal-dependent decarboxylase domain containing 1 (PDXDC1)
Clone Name :	ha07028 [Vector Info]
Flexi ORF Clone :	pF1KSDA0251
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3875 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1411 bp

Genome contig ID gi51511732f_14876461
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GAATGTTGGTTTCAATAAAGGTTCTTGAAATTGTT
Flanking genome sequence
(162585 - 162634)
----+----*----+----*----+----*----+----*----+----*
ACCAGTGAATTCAGTTTATAAATCTTATTACAAAAGACTTACCCACGTAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 14976461 15039044 23 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 820 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6P996	100.0	Pyridoxal-depen...	Homo sapiens
AAH60871	99.9	Pyridoxal-depen...	Homo sapiens
XP_001109439	95.1	similar to CG14...	Macaca mulatta
BAG58179	99.7	unnamed protein...	Homo sapiens
XP_547116	91.0	similar to CG14...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002129 246 301 PF00282 Pyridoxal phosphate-dependent decarboxylase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002129	246	301	PF00282	Pyridoxal phosphate-dependent decarboxylase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CACTGGGTTTCTGGACTGTAG
Primer_r	: GACTGTTTAATCATCTGCACC
PCR product length	: 142 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1411 bp
Genome contig ID	gi51511732f_14876461
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GAATGTTGGTTTCAATAAAGGTTCTTGAAATTGTT
Flanking genome sequence (162585 - 162634)	----+--------+--------+--------+--------+----* ACCAGTGAATTCAGTTTATAAATCTTATTACAAAAGACTTACCCACGTAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	14976461	15039044	23	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0251

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information