HUGE

Gene/Protein Characteristic Table for KIAA0253

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00480
Accession No. :	D87442
Description :	Nicastrin precursor.
HUGO Gene Name :	nicastrin (NCSTN)
Clone Name :	ha07036 [Vector Info]
Flexi ORF Clone :	pF1KSDA0253
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 2805 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 677 bp

Genome contig ID gi89161185f_158479813
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
TATATAATGAGTTTCATTAAAATAGATTATCCCAC
Flanking genome sequence
(115551 - 115600)
----+----*----+----*----+----*----+----*----+----*
ACGACTTGTACTGCTAGTTATTCTTCCCAGGCCACCTTGTTCAGCGAGCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 158579813 158595362 17 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 708 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92542	100.0	Nicastrin; Flag...	Homo sapiens
XP_001171763	99.7	nicastrin isofo...	Pan troglodytes
CAH91298	99.2	hypothetical pr...	Pongo abelii
BAE00862	98.9	unnamed protein...	Macaca fascicularis
CAH91017	98.7	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR008710 273 498 PF05450 Nicastrin

ScanRegExp IPR001680 276 290 PS00678 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008710	273	498	PF05450	Nicastrin
ScanRegExp	IPR001680	276	290	PS00678	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GACTGGGAAGGACATAAAAGG
Primer_r	: AGAAAGGACAGTGGGAAGGAG
PCR product length	: 109 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	677 bp
Genome contig ID	gi89161185f_158479813
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TATATAATGAGTTTCATTAAAATAGATTATCCCAC
Flanking genome sequence (115551 - 115600)	----+--------+--------+--------+--------+----* ACGACTTGTACTGCTAGTTATTCTTCCCAGGCCACCTTGTTCAGCGAGCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	158579813	158595362	17	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0253

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information