HUGE

Gene/Protein Characteristic Table for KIAA0256

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01062
Accession No. :	D87445
Description :
HUGO Gene Name :
Clone Name :	eg00512 [Vector Info]
Flexi ORF Clone :	pF1KA0256
Source :
Note :	We replaced ha04798, former representative clones for KIAA0256 with eg00512. (2001/10/06)

Features of the cloned DNA sequence	Description

Length: 6779 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3474 bp

Genome contig ID gi51511731r_46968259
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AAAAAACTAGCAAAATTAGTGTGAGTTATAACATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGGGATTTTCATCTTTTGCTGTATGAAGGATAATTGTTATATCACATTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 r 47068259 47125922 17 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1065 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001113528	0	95.3	hypothetical pr...	Macaca mulatta
CAM22356	2e-207	83.8	novel protein [...	Mus musculus
AAI67330	6.2e-166	68.2	Unknown (protei...	Xenopus (Silura...
CAH91943	2.8e-161	94.0	hypothetical pr...	Pongo abelii
EDL28147	1.6e-153	78.4	mCG6131 [Mus mu...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004038 666 768 PF01248 Ribosomal protein L7Ae/L30e/S12e/Gadd45

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004038	666	768	PF01248	Ribosomal protein L7Ae/L30e/S12e/Gadd45

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CTCATCCCTTCCAACCTTTAC
Primer_r	: GTACAGAAGAATCCCCACTAG
PCR product length	: 338 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3474 bp
Genome contig ID	gi51511731r_46968259
PolyA signal sequence (None)	+--------+--------+----*----+---- AAAAAACTAGCAAAATTAGTGTGAGTTATAACATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGGGATTTTCATCTTTTGCTGTATGAAGGATAATTGTTATATCACATTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	r	47068259	47125922	17	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0256

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information