HUGE

Gene/Protein Characteristic Table for KIAA0263

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01592
Accession No. :	D87452
Description :	Inositol hexaphosphate kinase 1.
HUGO Gene Name :	inositol hexaphosphate kinase 1 (IHPK1)
Clone Name :	pj01112 [Vector Info]
Flexi ORF Clone :	pF1KSDA0263
Source :	Human brain (hippocampus)
Note :	We replaced ha07068, former representative clones for KIAA0263 with pj01112. (2001/10/06)

Features of the cloned DNA sequence	Description

Length: 4455 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2827 bp

Genome contig ID gi89161205r_49636732
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GTCGTGTATGTCAAAAATAAAGCCGCTAGAAACGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGGCGAGTCTGTCTTTGTGAAAATCCCGTGGCCCGGGAGCCTTCCCTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 49736732 49798964 6 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 462 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q92551	1e-187	100.0	Inositol hexaki...	Homo sapiens
XP_001107338	2.5e-187	99.8	similar to inos...	Macaca mulatta
CAH90071	9.2e-185	98.9	hypothetical pr...	Pongo abelii
XP_001497210	2.1e-182	97.3	inositol hexaph...	Equus caballus
XP_850553	5.9e-181	96.4	similar to inos...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005522 156 455 PF03770 Inositol polyphosphate kinase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005522	156	455	PF03770	Inositol polyphosphate kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TGCGTTTGCTTTGGACCTTGC
Primer_r	: GACATACACGACCTCAGACAC
PCR product length	: 110 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2827 bp
Genome contig ID	gi89161205r_49636732
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GTCGTGTATGTCAAAAATAAAGCCGCTAGAAACGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGGCGAGTCTGTCTTTGTGAAAATCCCGTGGCCCGGGAGCCTTCCCTGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	49736732	49798964	6	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0263

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information