HUGE |
Gene/Protein Characteristic Table for KIAA0300 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06322 |
---|---|
Accession No. : | AB002298 |
Description : | PDZ domain-containing protein 2. |
HUGO Gene Name : | PDZ domain containing 2 (PDZD2) |
Clone Name : | hf00389s1 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hf00389, former representative clones for KIAA0300 with hf00389s1. (2003/4/2) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 11700 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2792 bp Genome contig ID gi51511721f_31734750 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
ATTTTAAAAAAAATAAACACTCTGCTTACTACTTGFlanking genome sequence
(412046 - 412095) ----+----*----+----*----+----*----+----*----+----*
ATTTTTTTTTTCTCTTTTGGCTGTTTGTTTGTTAATAATAGAGTAATATT
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 f 31834743 32146794 24 99.3 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 2847 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GTGCCAATTAAGTCAACCATC | |
: GTCCTACTAAAACTGTCATTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 5 |
: GeneBridge 4 | |
: GTGCCAATTAAGTCAACCATC | |
: GTCCTACTAAAACTGTCATTG | |
: 195 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |