HUGE

Gene/Protein Characteristic Table for KIAA0300

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06322
Accession No. :	AB002298
Description :	PDZ domain-containing protein 2.
HUGO Gene Name :	PDZ domain containing 2 (PDZD2)
Clone Name :	hf00389s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hf00389, former representative clones for KIAA0300 with hf00389s1. (2003/4/2)

Features of the cloned DNA sequence	Description

Length: 11700 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2792 bp

Genome contig ID gi51511721f_31734750
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
ATTTTAAAAAAAATAAACACTCTGCTTACTACTTG
Flanking genome sequence
(412046 - 412095)
----+----*----+----*----+----*----+----*----+----*
ATTTTTTTTTTCTCTTTTGGCTGTTTGTTTGTTAATAATAGAGTAATATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 31834743 32146794 24 99.3 Terminal No-hit

Features of the protein sequence	Description

Length: 2847 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O15018	100.0	PDZ domain-cont...	Homo sapiens
EAX10777	100.0	hCG2039413, iso...	Homo sapiens
XP_526957	98.5	PDZ domain cont...	Pan troglodytes
AAK07661	92.6	PDZ domain-cont...	Homo sapiens
BAG65554	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001478 342 424 PF00595 PDZ/DHR/GLGF

IPR001478 594 678 PF00595 PDZ/DHR/GLGF

IPR001478 736 819 PF00595 PDZ/DHR/GLGF

IPR001478 2630 2692 PF00595 PDZ/DHR/GLGF

IPR001478 2758 2841 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001478 89 187 SM00228 PDZ/DHR/GLGF

IPR001478 350 427 SM00228 PDZ/DHR/GLGF

IPR001478 603 681 SM00228 PDZ/DHR/GLGF

IPR001478 743 822 SM00228 PDZ/DHR/GLGF

IPR001478 2639 2715 SM00228 PDZ/DHR/GLGF

IPR001478 2766 2844 SM00228 PDZ/DHR/GLGF

ProfileScan IPR001478 102 168 PS50106 PDZ/DHR/GLGF

IPR001478 342 427 PS50106 PDZ/DHR/GLGF

IPR001478 594 680 PS50106 PDZ/DHR/GLGF

IPR001478 736 806 PS50106 PDZ/DHR/GLGF

IPR001478 2630 2702 PS50106 PDZ/DHR/GLGF

IPR001478 2758 2843 PS50106 PDZ/DHR/GLGF

ScanRegExp IPR000719 745 775 PS00107 Protein kinase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	342	424	PF00595	PDZ/DHR/GLGF
IPR001478	594	678	PF00595	PDZ/DHR/GLGF
IPR001478	736	819	PF00595	PDZ/DHR/GLGF
IPR001478	2630	2692	PF00595	PDZ/DHR/GLGF
IPR001478	2758	2841	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	89	187	SM00228	PDZ/DHR/GLGF
IPR001478	350	427	SM00228	PDZ/DHR/GLGF
IPR001478	603	681	SM00228	PDZ/DHR/GLGF
IPR001478	743	822	SM00228	PDZ/DHR/GLGF
IPR001478	2639	2715	SM00228	PDZ/DHR/GLGF
IPR001478	2766	2844	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	102	168	PS50106	PDZ/DHR/GLGF
IPR001478	342	427	PS50106	PDZ/DHR/GLGF
IPR001478	594	680	PS50106	PDZ/DHR/GLGF
IPR001478	736	806	PS50106	PDZ/DHR/GLGF
IPR001478	2630	2702	PS50106	PDZ/DHR/GLGF
IPR001478	2758	2843	PS50106	PDZ/DHR/GLGF
ScanRegExp	IPR000719	745	775	PS00107	Protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GTGCCAATTAAGTCAACCATC

Primer_r
: GTCCTACTAAAACTGTCATTG

PCR conditions
: 95 °C15 sec62 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTGCCAATTAAGTCAACCATC
Primer_r	: GTCCTACTAAAACTGTCATTG
PCR product length	: 195 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2792 bp
Genome contig ID	gi51511721f_31734750
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ATTTTAAAAAAAATAAACACTCTGCTTACTACTTG
Flanking genome sequence (412046 - 412095)	----+--------+--------+--------+--------+----* ATTTTTTTTTTCTCTTTTGGCTGTTTGTTTGTTAATAATAGAGTAATATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	31834743	32146794	24	99.3	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0300

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information