HUGE

Gene/Protein Characteristic Table for KIAA0301

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05953
Accession No. :	AB002299
Description :	Midasin.
HUGO Gene Name :	MDN1, midasin homolog (yeast) (MDN1)
Clone Name :	hf00402s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hf00402, former representative clones for KIAA0301 with hf00402s1. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 11140 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1506 bp

Genome contig ID gi89161210r_90308939
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GGAGGCTTATAAAAATAAATTATCCTCCATAAATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGATGTTGCATCCCACTCACATTTCATTGGCTAAAGCCCTCTATGGGGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 90408939 90479648 56 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 3210 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW48545	100.0	MDN1, midasin h...	Homo sapiens
Q9NU22	100.0	Midasin; MIDAS-...	Homo sapiens
XP_518639	99.3	MDN1, midasin h...	Pan troglodytes
XP_001091687	96.8	MDN1, midasin h...	Macaca mulatta
XP_001915456	87.1	similar to Mida...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR002035 2996 3177 SM00327 von Willebrand factor

ProfileScan IPR002035 2998 3197 PS50234 von Willebrand factor

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR002035	2996	3177	SM00327	von Willebrand factor
ProfileScan	IPR002035	2998	3197	PS50234	von Willebrand factor

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CTTATAAGGCTACACCAACTC

Primer_r
: GCTAACATGATCCCCTCCTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTTATAAGGCTACACCAACTC
Primer_r	: GCTAACATGATCCCCTCCTAC
PCR product length	: 138 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1506 bp
Genome contig ID	gi89161210r_90308939
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GGAGGCTTATAAAAATAAATTATCCTCCATAAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGATGTTGCATCCCACTCACATTTCATTGGCTAAAGCCCTCTATGGGGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	90408939	90479648	56	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0301

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information