HUGE |
Gene/Protein Characteristic Table for KIAA0319 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00504 |
---|---|
Accession No. : | AB002317 |
Description : | |
HUGO Gene Name : | |
Clone Name : | hg00378 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0319
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6791 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3061 bp Genome contig ID gi89161210r_24552469 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
TGTGTTCATAAATAAAGTTTTATTGGAACATATCCFlanking genome sequence
(99842 - 99793) ----+----*----+----*----+----*----+----*----+----*
ACATTCACTGATTTATGTATTATCTATGGCTGTTCTTATGTTACAACAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 r 24652311 24754362 21 99.1 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1109 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: AGACCCACTTTTCGGCTCATG | |
: TTTATGCTTCAGGGTAGAGGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 6 |
: GeneBridge 4 | |
: AGACCCACTTTTCGGCTCATG | |
: TTTATGCTTCAGGGTAGAGGG | |
: 97 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |