HUGE

Gene/Protein Characteristic Table for KIAA0330

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00053
Accession No. :	AB002328
Description :	Calcineurin-binding protein Cabin 1.
HUGO Gene Name :	calcineurin binding protein 1 (CABIN1)
Clone Name :	hg00894s1 [Vector Info]
Flexi ORF Clone :	pF1KA0330
Source :	Human adult brain
Note :	We replaced hg00894, former representative clones for KIAA0330 with hg00894s1. (2003/4/2)

Features of the cloned DNA sequence	Description

Length: 7445 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 432 bp

Genome contig ID gi89161203f_22637903
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TTTTTGGTTGCTTTTCTAATAAAGATGGAACAGTT
Flanking genome sequence
(266695 - 266744)
----+----*----+----*----+----*----+----*----+----*
GTCTTTGCCTCTTTGCTCACCTCTAGGGGGCAATCTGGCAGAGTCTCTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 f 22737903 22904596 37 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 2224 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y6J0	100.0	Calcineurin-bin...	Homo sapiens
XP_515030	99.3	calcineurin bin...	Pan troglodytes
XP_543529	90.9	similar to Calc...	Canis lupus fam...
EDL31891	88.7	calcineurin bin...	Mus musculus
O88480	88.0	Calcineurin-bin...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001440 94 127 PF00515 Tetratricopeptide TPR_1

IPR001440 128 161 PF00515 Tetratricopeptide TPR_1

IPR001440 1130 1143 PF00515 Tetratricopeptide TPR_1

IPR015134 2160 2194 PF09047 MEF2 binding

HMMSmart IPR013026 40 73 SM00028 Tetratricopeptide region

IPR013026 94 127 SM00028 Tetratricopeptide region

IPR013026 128 161 SM00028 Tetratricopeptide region

IPR013026 619 652 SM00028 Tetratricopeptide region

IPR013026 1059 1092 SM00028 Tetratricopeptide region

ProfileScan IPR013026 94 127 PS50005 Tetratricopeptide region

IPR013026 94 161 PS50293 Tetratricopeptide region

IPR013026 128 161 PS50005 Tetratricopeptide region

IPR013026 619 652 PS50005 Tetratricopeptide region

IPR013026 1059 1092 PS50005 Tetratricopeptide region

IPR013026 1059 1092 PS50293 Tetratricopeptide region

ScanRegExp IPR001091 1349 1354 PS00093 Site-specific DNA-methyltransferase (cytosine-N4-specific)

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001440	94	127	PF00515	Tetratricopeptide TPR_1
IPR001440	128	161	PF00515	Tetratricopeptide TPR_1
IPR001440	1130	1143	PF00515	Tetratricopeptide TPR_1
IPR015134	2160	2194	PF09047	MEF2 binding
HMMSmart	IPR013026	40	73	SM00028	Tetratricopeptide region
IPR013026	94	127	SM00028	Tetratricopeptide region
IPR013026	128	161	SM00028	Tetratricopeptide region
IPR013026	619	652	SM00028	Tetratricopeptide region
IPR013026	1059	1092	SM00028	Tetratricopeptide region
ProfileScan	IPR013026	94	127	PS50005	Tetratricopeptide region
IPR013026	94	161	PS50293	Tetratricopeptide region
IPR013026	128	161	PS50005	Tetratricopeptide region
IPR013026	619	652	PS50005	Tetratricopeptide region
IPR013026	1059	1092	PS50005	Tetratricopeptide region
IPR013026	1059	1092	PS50293	Tetratricopeptide region
ScanRegExp	IPR001091	1349	1354	PS00093	Site-specific DNA-methyltransferase (cytosine-N4-specific)

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AAAAAGGGTGAGGGGTGAGCC

Primer_r
: TGTGAAGGTGGATTGGTCGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAAAAGGGTGAGGGGTGAGCC
Primer_r	: TGTGAAGGTGGATTGGTCGCC
PCR product length	: 181 bp
PCR conditions	: 95 °C15 sec68 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	432 bp
Genome contig ID	gi89161203f_22637903
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTTTTGGTTGCTTTTCTAATAAAGATGGAACAGTT
Flanking genome sequence (266695 - 266744)	----+--------+--------+--------+--------+----* GTCTTTGCCTCTTTGCTCACCTCTAGGGGGCAATCTGGCAGAGTCTCTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	f	22737903	22904596	37	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0330

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information