HUGE |
Gene/Protein Characteristic Table for KIAA0330 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00053 |
---|---|
Accession No. : | AB002328 |
Description : | Calcineurin-binding protein Cabin 1. |
HUGO Gene Name : | calcineurin binding protein 1 (CABIN1) |
Clone Name : | hg00894s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0330
![]() |
Source : | Human adult brain |
Note : | We replaced hg00894, former representative clones for KIAA0330 with hg00894s1. (2003/4/2) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7445 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 432 bp Genome contig ID gi89161203f_22637903 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TTTTTGGTTGCTTTTCTAATAAAGATGGAACAGTTFlanking genome sequence
(266695 - 266744) ----+----*----+----*----+----*----+----*----+----*
GTCTTTGCCTCTTTGCTCACCTCTAGGGGGCAATCTGGCAGAGTCTCTGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 f 22737903 22904596 37 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2224 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: AAAAAGGGTGAGGGGTGAGCC | |
: TGTGAAGGTGGATTGGTCGCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 22 |
: GeneBridge 4 | |
: AAAAAGGGTGAGGGGTGAGCC | |
: TGTGAAGGTGGATTGGTCGCC | |
: 181 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |