HUGE

Gene/Protein Characteristic Table for KIAA0333

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01068
Accession No. :	AB002331
Description :	Death-inducer obliterator 1.
HUGO Gene Name :	death inducer-obliterator 1 (DIDO1)
Clone Name :	pf04993 [Vector Info]
Flexi ORF Clone :	pF1KA0333
Source :	Human brain (hippocampus)
Note :	We replaced hg00988, former representative clones for KIAA0333 with pf04993. (2001/10/06)

Features of the cloned DNA sequence	Description

Length: 7013 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3155 bp

Genome contig ID gi51511747r_60889014
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
CCTTCTCCTCCTAAATCAATAAACATCTTTCATGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACTGGTCCTTGTTTGTTTGAATTGGAACCATTTGGTGGCTCCTGGTCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 60989014 61039681 16 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1223 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI95770	100.0	death inducer-o...	Homo sapiens
AAS49898	99.8	death inducer-o...	Homo sapiens
Q9BTC0	100.0	Death-inducer o...	Homo sapiens
NP_149072	100.0	death inducer-o...	Homo sapiens
AAS49899	99.8	death inducer-o...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87685	1.3e-14	37.4	KIAA0244

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001965 304 356 PF00628 Zinc finger

IPR003618 704 818 PF07500 Transcription elongation factor S-II

IPR012921 1091 1197 PF07744 Spen paralogue and orthologue C-terminal

HMMSmart IPR001965 304 354 SM00249 Zinc finger

IPR003618 706 807 SM00510 Transcription elongation factor S-II

ProfileScan IPR001965 302 356 PS50016 Zinc finger

ScanRegExp IPR001965 305 353 PS01359 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	304	356	PF00628	Zinc finger
IPR003618	704	818	PF07500	Transcription elongation factor S-II
IPR012921	1091	1197	PF07744	Spen paralogue and orthologue C-terminal
HMMSmart	IPR001965	304	354	SM00249	Zinc finger
IPR003618	706	807	SM00510	Transcription elongation factor S-II
ProfileScan	IPR001965	302	356	PS50016	Zinc finger
ScanRegExp	IPR001965	305	353	PS01359	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TCCATGCAAAGCTACTGTTAC

Primer_r
: CTGCTCGAATGGAAAGGGCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCCATGCAAAGCTACTGTTAC
Primer_r	: CTGCTCGAATGGAAAGGGCTC
PCR product length	: 202 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3155 bp
Genome contig ID	gi51511747r_60889014
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CCTTCTCCTCCTAAATCAATAAACATCTTTCATGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTGGTCCTTGTTTGTTTGAATTGGAACCATTTGGTGGCTCCTGGTCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	60989014	61039681	16	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0333

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information