HUGE |
Gene/Protein Characteristic Table for KIAA0333 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01068 |
---|---|
Accession No. : | AB002331 |
Description : | Death-inducer obliterator 1. |
HUGO Gene Name : | death inducer-obliterator 1 (DIDO1) |
Clone Name : | pf04993 [Vector Info] |
Flexi ORF Clone : | pF1KA0333 |
Source : | Human brain (hippocampus) |
Note : | We replaced hg00988, former representative clones for KIAA0333 with pf04993. (2001/10/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7013 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 3155 bp Genome contig ID gi51511747r_60889014 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
CCTTCTCCTCCTAAATCAATAAACATCTTTCATGGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAACTGGTCCTTGTTTGTTTGAATTGGAACCATTTGGTGGCTCCTGGTCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 r 60989014 61039681 16 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1223 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: TCCATGCAAAGCTACTGTTAC | |
: CTGCTCGAATGGAAAGGGCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 20 |
: GeneBridge 4 | |
: TCCATGCAAAGCTACTGTTAC | |
: CTGCTCGAATGGAAAGGGCTC | |
: 202 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |