HUGE

Gene/Protein Characteristic Table for KIAA0340

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06655
Accession No. :	AB002338
Description :	Regulating synaptic membrane exocytosis protein 1.
HUGO Gene Name :	regulating synaptic membrane exocytosis 1 (RIMS1)
Clone Name :	hg01396 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6395 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3231 bp

Genome contig ID gi89161210f_72553371
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTAGATAACAAGAGTGAGACTCTGTCTCAAAAAAG
Flanking genome sequence
(490642 - 490691)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAGAATATTTTCTAGAAATTGAGGAAATTTAAAACATTGATGAAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 72653371 73044011 21 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 1053 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB87121	100.0	RIM short form ...	Homo sapiens
BAB87242	100.0	RIM long form [...	Homo sapiens
AAY96658	99.1	regulating syna...	Macaca mulatta
AAY96657	99.0	regulating syna...	Macaca mulatta
AAB66703	88.7	rab3 effector [...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018294	2.6e-58	56.0	KIAA0751

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000008 788 800 PR00360 C2 calcium-dependent membrane targeting

IPR000008 817 830 PR00360 C2 calcium-dependent membrane targeting

IPR000008 842 850 PR00360 C2 calcium-dependent membrane targeting

HMMPfam IPR001478 619 702 PF00595 PDZ/DHR/GLGF

IPR000008 773 864 PF00168 C2 calcium-dependent membrane targeting

HMMSmart IPR001478 628 707 SM00228 PDZ/DHR/GLGF

IPR000008 772 879 SM00239 C2 calcium-dependent membrane targeting

ProfileScan IPR010911 47 207 PS50916 Rab-binding

IPR000306 135 195 PS50178 Zinc finger

IPR001478 619 705 PS50106 PDZ/DHR/GLGF

IPR000008 769 864 PS50004 C2 calcium-dependent membrane targeting

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	788	800	PR00360	C2 calcium-dependent membrane targeting
IPR000008	817	830	PR00360	C2 calcium-dependent membrane targeting
IPR000008	842	850	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR001478	619	702	PF00595	PDZ/DHR/GLGF
IPR000008	773	864	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR001478	628	707	SM00228	PDZ/DHR/GLGF
IPR000008	772	879	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR010911	47	207	PS50916	Rab-binding
IPR000306	135	195	PS50178	Zinc finger
IPR001478	619	705	PS50106	PDZ/DHR/GLGF
IPR000008	769	864	PS50004	C2 calcium-dependent membrane targeting

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CGACAATAAGATAGGGAGTGG

Primer_r
: CTCATGTTGTCTCTATCTCCA

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTAGTAGAGACGGGGTTTCAC
Primer_r	: AGGAGTTGAAAAGAAGAGTCG
PCR product length	: 170 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3231 bp
Genome contig ID	gi89161210f_72553371
PolyA signal sequence (None)	+--------+--------+----*----+---- CTAGATAACAAGAGTGAGACTCTGTCTCAAAAAAG
Flanking genome sequence (490642 - 490691)	----+--------+--------+--------+--------+----* AAAAAAAGAATATTTTCTAGAAATTGAGGAAATTTAAAACATTGATGAAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	72653371	73044011	21	99.1	Perfect prediction

Primer_f	: CGACAATAAGATAGGGAGTGG
Primer_r	: CTCATGTTGTCTCTATCTCCA
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0340

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information