HUGE |
Gene/Protein Characteristic Table for KIAA0345 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05594 |
---|---|
Accession No. : | AB002343 |
Description : | Protocadherin alpha 9 precursor. |
HUGO Gene Name : | protocadherin alpha 9 (PCDHA9) |
Clone Name : | hg01491 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6387 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3134 bp Genome contig ID gi51511721f_140107541 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GCATTTCAGCCCGGGTGACAGCGAGATTCTGTCTCFlanking genome sequence
(106389 - 106438) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAGAGTAGTTTAACTACTCCCTACTTTTTATTCAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 f 140207541 140213928 1 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 845 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: TGCTCTTACTACCCATTTCAG | |
: CGCATTAGCATTAGCAGCACC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 5 |
: GeneBridge 4 | |
: TGCTCTTACTACCCATTTCAG | |
: CGCATTAGCATTAGCAGCACC | |
: 88 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |