HUGE

Gene/Protein Characteristic Table for KIAA0360

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00516
Accession No. :	AB002358
Description :	Sal-like protein 2.
HUGO Gene Name :	sal-like 2 (Drosophila) (SALL2)
Clone Name :	hh00062s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0360
Source :	Human adult brain
Note :	We replaced hh00062, former representative clones for KIAA0360 with hh00062s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4910 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1604 bp

Genome contig ID gi51511730r_20959074
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
GTGTCTTTCCCTCTATCATTAAAGGTGTTTTAACC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATATTTATGTGTTTCTCCTTATTTCATGATTACATAGCCAGCTGGGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 21059074 21075177 2 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 1019 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW66378	100.0	sal-like 2 (Dro...	Homo sapiens
NP_005398	99.9	sal-like 2 [Hom...	Homo sapiens
Q9Y467	99.9	Sal-like protei...	Homo sapiens
XP_001154944	99.3	sal-like 2 isof...	Pan troglodytes
EAW66377	98.2	sal-like 2 (Dro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007087 385 407 PF00096 Zinc finger

IPR007087 413 435 PF00096 Zinc finger

IPR007087 671 693 PF00096 Zinc finger

IPR007087 703 725 PF00096 Zinc finger

IPR007087 923 945 PF00096 Zinc finger

IPR007087 952 975 PF00096 Zinc finger

HMMSmart IPR015880 385 407 SM00355 Zinc finger

IPR015880 413 435 SM00355 Zinc finger

IPR015880 643 665 SM00355 Zinc finger

IPR015880 671 693 SM00355 Zinc finger

IPR015880 703 725 SM00355 Zinc finger

IPR015880 923 945 SM00355 Zinc finger

IPR015880 952 975 SM00355 Zinc finger

ProfileScan IPR007087 385 412 PS50157 Zinc finger

IPR007087 413 440 PS50157 Zinc finger

IPR007087 643 670 PS50157 Zinc finger

IPR007087 671 698 PS50157 Zinc finger

IPR007087 703 730 PS50157 Zinc finger

IPR007087 923 950 PS50157 Zinc finger

IPR007087 952 980 PS50157 Zinc finger

ScanRegExp IPR007087 387 407 PS00028 Zinc finger

IPR007087 415 435 PS00028 Zinc finger

IPR007087 645 665 PS00028 Zinc finger

IPR007087 673 693 PS00028 Zinc finger

IPR007087 705 725 PS00028 Zinc finger

IPR007087 925 945 PS00028 Zinc finger

IPR007087 954 976 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	385	407	PF00096	Zinc finger
IPR007087	413	435	PF00096	Zinc finger
IPR007087	671	693	PF00096	Zinc finger
IPR007087	703	725	PF00096	Zinc finger
IPR007087	923	945	PF00096	Zinc finger
IPR007087	952	975	PF00096	Zinc finger
HMMSmart	IPR015880	385	407	SM00355	Zinc finger
IPR015880	413	435	SM00355	Zinc finger
IPR015880	643	665	SM00355	Zinc finger
IPR015880	671	693	SM00355	Zinc finger
IPR015880	703	725	SM00355	Zinc finger
IPR015880	923	945	SM00355	Zinc finger
IPR015880	952	975	SM00355	Zinc finger
ProfileScan	IPR007087	385	412	PS50157	Zinc finger
IPR007087	413	440	PS50157	Zinc finger
IPR007087	643	670	PS50157	Zinc finger
IPR007087	671	698	PS50157	Zinc finger
IPR007087	703	730	PS50157	Zinc finger
IPR007087	923	950	PS50157	Zinc finger
IPR007087	952	980	PS50157	Zinc finger
ScanRegExp	IPR007087	387	407	PS00028	Zinc finger
IPR007087	415	435	PS00028	Zinc finger
IPR007087	645	665	PS00028	Zinc finger
IPR007087	673	693	PS00028	Zinc finger
IPR007087	705	725	PS00028	Zinc finger
IPR007087	925	945	PS00028	Zinc finger
IPR007087	954	976	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GAGAAGCCCATCATAGACAAG

Primer_r
: CCTTCCTTCATTTCTCCCTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACTAATATCTCCCGTCTGTTC
Primer_r	: TGCTATTGACTGACTTGAACG
PCR product length	: 97 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1604 bp
Genome contig ID	gi51511730r_20959074
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- GTGTCTTTCCCTCTATCATTAAAGGTGTTTTAACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATATTTATGTGTTTCTCCTTATTTCATGATTACATAGCCAGCTGGGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	21059074	21075177	2	99.1	Perfect prediction

Primer_f	: GAGAAGCCCATCATAGACAAG
Primer_r	: CCTTCCTTCATTTCTCCCTAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0360

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information