HUGE

Gene/Protein Characteristic Table for KIAA0363

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00060
Accession No. :	AB002361
Description :	NAC-alpha domain-containing protein 1.
HUGO Gene Name :	NAC alpha domain containing (NACAD)
Clone Name :	hh00103 [Vector Info]
Flexi ORF Clone :	pF1KA0363
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4642 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1522 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O15069	100.0	NAC-alpha domai...	Homo sapiens
XP_166571	99.9	NAC alpha domai...	Homo sapiens
BAG10323	100.0	NAC-alpha domai...	synthetic construct
XP_001717233	97.2	similar to NAC-...	Homo sapiens
EAW61057	97.2	hCG1640770 [Hom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002715 1372 1431 PF01849 Nascent polypeptide-associated complex NAC

ProfileScan IPR002715 1371 1436 PS51151 Nascent polypeptide-associated complex NAC

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002715	1372	1431	PF01849	Nascent polypeptide-associated complex NAC
ProfileScan	IPR002715	1371	1436	PS51151	Nascent polypeptide-associated complex NAC

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TTCCGGTCAGTGGCTACATGG

Primer_r
: CTGCGTGACATTGAGCTGGTG

PCR conditions
: 95 °C30 sec66 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTCCGGTCAGTGGCTACATGG
Primer_r	: CTGCGTGACATTGAGCTGGTG
PCR product length	: 130 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0363

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information