HUGE |
Gene/Protein Characteristic Table for KIAA0370 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07379 |
---|---|
Accession No. : | AB002368 |
Description : | Exportin-6. |
HUGO Gene Name : | exportin 6 (XPO6) |
Clone Name : | sj06874 [Vector Info] |
Flexi ORF Clone : | pF1KA0370
![]() |
Source : | |
Note : | We replaced hh00184 and hh00184s1, former representative clones for KIAA0370 with sj06874. (2002/5/10,2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4422 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 543 bp Genome contig ID gi51511732r_27916817 PolyA signal sequence
(AATAAA,-11) +----*----+----*----+----*----+----
AAACTAAGAAGCTTAATGAAAAGAAATAAAATGCCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TATGTTGTTGTTCTAGAAACCCTGGCTGGGGAGCTGCTTGCTACTCACAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 r 28016817 28130691 24 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1132 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001494 | 38 | 104 | PF03810 | Importin-beta |
IPR013598 | 110 | 260 | PF08389 | Exportin-1/Importin-beta-like | |
ProfileScan | IPR001494 | 38 | 104 | PS50166 | Importin-beta |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: CGTCACATCTCTCCTTGGCTG | |
: ACTAGGAGGCACCAGGAAATC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 16 |
: GeneBridge 4 | |
: CGTCACATCTCTCCTTGGCTG | |
: ACTAGGAGGCACCAGGAAATC | |
: 133 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |