HUGE

Gene/Protein Characteristic Table for KIAA0377

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00062
Accession No. :	AB002375
Description :	histidine acid phosphatase domain containing 2A isoform 2.
HUGO Gene Name :	histidine acid phosphatase domain containing 2B (pseudogene) (HISPPD2B)
Clone Name :	hh00412 [Vector Info]
Flexi ORF Clone :	pF1KA0377
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5544 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1197 bp

Genome contig ID gi51511731r_41512967
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ACATTATGAGTGCTCAATAAATATAAACTAATGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATGGTGGTGATGGATGATGGTGATGTCCTTGTGAATTCAAGAATGAATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 r 41612967 41664386 29 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1412 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11175	100.0	histidine acid ...	synthetic construct
CAI46011	93.9	hypothetical pr...	Homo sapiens
CAD97968	93.9	hypothetical pr...	Homo sapiens
XP_510352	93.7	Histidine acid ...	Pan troglodytes
XP_535450	87.6	similar to CG14...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007893	3.4e-176	75.1	KIAA0433

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000560 396 912 PF00328 Histidine acid phosphatase

ScanRegExp IPR000560 397 411 PS00616 Histidine acid phosphatase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000560	396	912	PF00328	Histidine acid phosphatase
ScanRegExp	IPR000560	397	411	PS00616	Histidine acid phosphatase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GCACTCATAATGTTCCAGCCC

Primer_r
: CAAAGACCAAACACTGCAGGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCACTCATAATGTTCCAGCCC
Primer_r	: CAAAGACCAAACACTGCAGGG
PCR product length	: 166 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1197 bp
Genome contig ID	gi51511731r_41512967
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACATTATGAGTGCTCAATAAATATAAACTAATGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGGTGGTGATGGATGATGGTGATGTCCTTGTGAATTCAAGAATGAATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	r	41612967	41664386	29	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0377

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information