HUGE |
Gene/Protein Characteristic Table for KIAA0383 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00523 |
---|---|
Accession No. : | AB002381 |
Description : | Histone acetyltransferase MYST4. |
HUGO Gene Name : | |
Clone Name : | hh00708s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0383
![]() |
Source : | Human adult brain |
Note : | We replaced hh00708, former representative clones for KIAA0383 with hh00708s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6592 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1246 bp Genome contig ID gi89161187f_76172622 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
TTTTAACATAAAATAAATTATGATGAGCCATTTTTFlanking genome sequence
(289436 - 289485) ----+----*----+----*----+----*----+----*----+----*
AGCCTCTTGTGTCCTGTCATATTATGATTGATAGAGAATGACCAATGGAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 f 76272622 76462056 16 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1781 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GATTACGCCTCTCCTGCTTGG | |
: GTGTCTGTTTATATTGCTTCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 10 |
: GeneBridge 4 | |
: GATTACGCCTCTCCTGCTTGG | |
: GTGTCTGTTTATATTGCTTCC | |
: 83 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |