HUGE |
Gene/Protein Characteristic Table for KIAA0392 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04897 |
---|---|
Accession No. : | AB002390 |
Description : | Ectonucleoside triphosphate diphosphohydrolase 4. |
HUGO Gene Name : | ectonucleoside triphosphate diphosphohydrolase 4 (ENTPD4) |
Clone Name : | hh00034 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5422 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3769 bp Genome contig ID gi51511724r_23242621 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
ACTGAAAAATCAATAAAACGAAAGTTCATCATCCCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATGGCCCGTAGACTGTGTGGGCTTGCTTCCTTGTCATCTTTGAATCTTCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 8 r 23342621 23362231 11 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 550 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GACCTTCCGAGAGTATTATTC | |
: TGAATGATGTGACCAACCAAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 8 |
: GeneBridge 4 | |
: GACCTTCCGAGAGTATTATTC | |
: TGAATGATGTGACCAACCAAG | |
: 153 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |