HUGE |
Gene/Protein Characteristic Table for KIAA0398 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00528 |
---|---|
Accession No. : | AB007858 |
Description : | mRNA cap guanine-N7 methyltransferase. |
HUGO Gene Name : | |
Clone Name : | hg00376 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0398
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6203 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 4576 bp Genome contig ID gi51511735f_13620625 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
TTCATTGTGTGAATAAACCACATACTGTTTATCTGFlanking genome sequence
(133931 - 133980) ----+----*----+----*----+----*----+----*----+----*
ACAGCTGTTTGGTTCATTTACCATTTGGAAACTAGTACTGATCCAGATAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 18 f 13716704 13754554 12 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 476 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GAAACCAGATACGAAGAATGC | |
: ATACAATCGGCACCCCAGAAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 18 |
: GeneBridge 4 | |
: GAAACCAGATACGAAGAATGC | |
: ATACAATCGGCACCCCAGAAG | |
: 156 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |