HUGE

Gene/Protein Characteristic Table for KIAA0408

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04402
Accession No. :	AB007868
Description :	Uncharacterized protein C6orf174 precursor.
HUGO Gene Name :
Clone Name :	hg01359 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6581 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3767 bp

Genome contig ID gi89161210r_127703460
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTGGGTGACAGAGTGAGACTCTGTCTC
Flanking genome sequence
(99721 - 99672)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAGAACTTATAACTATGACTTGTTCATCTCACCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 127803181 127814054 4 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 662 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001106088	0	93.4	similar to Temp...	Macaca mulatta
CAB65988	0	100.0	chromosome 6 op...	Homo sapiens
BAE02197	1.1e-192	94.5	unnamed protein...	Macaca fascicularis
XP_001789772	2.6e-134	70.8	hypothetical pr...	Bos taurus
EDL87692	1.5e-93	55.2	rCG42077, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GCGTGGGTGCGGCTGTTAAAC

Primer_r
: GGCTTTCTCTTTAGGCTTGGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCGTGGGTGCGGCTGTTAAAC
Primer_r	: GGCTTTCTCTTTAGGCTTGGG
PCR product length	: 107 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3767 bp
Genome contig ID	gi89161210r_127703460
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGTGACAGAGTGAGACTCTGTCTC
Flanking genome sequence (99721 - 99672)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAGAACTTATAACTATGACTTGTTCATCTCACCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	127803181	127814054	4	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0408

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information