HUGE

Gene/Protein Characteristic Table for KIAA0409

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00068
Accession No. :	AB007869
Description :	Cerebral protein 1.
HUGO Gene Name :
Clone Name :	hg01499 [Vector Info]
Flexi ORF Clone :	pF1KA0409
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6469 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5074 bp

Genome contig ID gi51511727r_6473043
PolyA signal sequence
(AATAAA,-12)
+----*----+----*----+----*----+----
CTGAGATCCTGTCTCAATAAATAAATAAAACAATT
Flanking genome sequence
(99838 - 99789)
----+----*----+----*----+----*----+----*----+----*
ATATATATGTATAATATATAATATTATATATACATATGTATGTATGATGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 6572881 6581332 7 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 464 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001100895	4.2e-153	93.5	similar to T07A...	Macaca mulatta
XP_534039	2.5e-128	81.3	similar to T07A...	Canis lupus fam...
BAE42874	1.3e-118	76.6	unnamed protein...	Mus musculus
BAE41665	2.4e-118	76.4	unnamed protein...	Mus musculus
Q9DB85	2.4e-117	76.0	Cerebral protei...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007823 245 464 PF05148 Methyltransferases-related

ScanRegExp IPR004033 388 402 PS01184 UbiE/COQ5 methyltransferase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007823	245	464	PF05148	Methyltransferases-related
ScanRegExp	IPR004033	388	402	PS01184	UbiE/COQ5 methyltransferase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AGGAGCTGTGGGCAATTAAGG

Primer_r
: TTGGCATTGGTTCTGGAGCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGGAGCTGTGGGCAATTAAGG
Primer_r	: TTGGCATTGGTTCTGGAGCTG
PCR product length	: 153 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5074 bp
Genome contig ID	gi51511727r_6473043
PolyA signal sequence (AATAAA,-12)	+--------+--------+----*----+---- CTGAGATCCTGTCTCAATAAATAAATAAAACAATT
Flanking genome sequence (99838 - 99789)	----+--------+--------+--------+--------+----* ATATATATGTATAATATATAATATTATATATACATATGTATGTATGATGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	6572881	6581332	7	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0409

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information