HUGE |
Gene/Protein Characteristic Table for KIAA0421 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06907 |
---|---|
Accession No. : | AB007881 |
Description : | Serine/threonine-protein kinase SMG1. |
HUGO Gene Name : | |
Clone Name : | hh01158s1 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hh01158, former representative clones for KIAA0421 with hh01158s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7775 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1808 bp Genome contig ID gi51511732r_18626884 PolyA signal sequence
(AATAAA,-15) +----*----+----*----+----*----+----
GAGCTAGACTCTGTGTCAAAAATAAATGACTAGATFlanking genome sequence
(99699 - 99650) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAATTGTTTGAGTACATTTTCCCTGCATTTTAGAGATTAGGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 r 18726583 18770922 31 99.7 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1988 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GGGTTTTTATTTTGGATCAGC | |
: AGTTATTAGTCTGTGAAGTGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 16 |
: GeneBridge 4 | |
: GGGTTTTTATTTTGGATCAGC | |
: AGTTATTAGTCTGTGAAGTGC | |
: 111 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |