HUGE

Gene/Protein Characteristic Table for KIAA0421

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06907
Accession No. :	AB007881
Description :	Serine/threonine-protein kinase SMG1.
HUGO Gene Name :
Clone Name :	hh01158s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hh01158, former representative clones for KIAA0421 with hh01158s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 7775 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1808 bp

Genome contig ID gi51511732r_18626884
PolyA signal sequence
(AATAAA,-15)
+----*----+----*----+----*----+----
GAGCTAGACTCTGTGTCAAAAATAAATGACTAGAT
Flanking genome sequence
(99699 - 99650)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAATTGTTTGAGTACATTTTCCCTGCATTTTAGAGATTAGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 r 18726583 18770922 31 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1988 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAK00511	100.0	PI-3-kinase-rel...	Homo sapiens
AAM73708	100.0	PI-3-kinase ATX...	Homo sapiens
EAW50263	100.0	hCG1994151, iso...	Homo sapiens
EAW50260	100.0	hCG1994151, iso...	Homo sapiens
EAW50261	100.0	hCG1994151, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002371	0.00015	20.5	KIAA0373

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000357 144 179 PF02985 HEAT

IPR000403 476 754 PF00454 Phosphatidylinositol 3- and 4-kinase

IPR003152 1956 1988 PF02260 PIK-related kinase

HMMSmart IPR000403 478 809 SM00146 Phosphatidylinositol 3- and 4-kinase

ProfileScan IPR014009 1 193 PS51189 PIK-related kinase

IPR000403 477 805 PS50290 Phosphatidylinositol 3- and 4-kinase

IPR003152 1956 1988 PS51190 PIK-related kinase

ScanRegExp IPR000403 647 667 PS00916 Phosphatidylinositol 3- and 4-kinase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	144	179	PF02985	HEAT
IPR000403	476	754	PF00454	Phosphatidylinositol 3- and 4-kinase
IPR003152	1956	1988	PF02260	PIK-related kinase
HMMSmart	IPR000403	478	809	SM00146	Phosphatidylinositol 3- and 4-kinase
ProfileScan	IPR014009	1	193	PS51189	PIK-related kinase
IPR000403	477	805	PS50290	Phosphatidylinositol 3- and 4-kinase
IPR003152	1956	1988	PS51190	PIK-related kinase
ScanRegExp	IPR000403	647	667	PS00916	Phosphatidylinositol 3- and 4-kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GGGTTTTTATTTTGGATCAGC

Primer_r
: AGTTATTAGTCTGTGAAGTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGGTTTTTATTTTGGATCAGC
Primer_r	: AGTTATTAGTCTGTGAAGTGC
PCR product length	: 111 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1808 bp
Genome contig ID	gi51511732r_18626884
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- GAGCTAGACTCTGTGTCAAAAATAAATGACTAGAT
Flanking genome sequence (99699 - 99650)	----+--------+--------+--------+--------+----* AAAAAAAAAAATTGTTTGAGTACATTTTCCCTGCATTTTAGAGATTAGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	r	18726583	18770922	31	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0421

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information