| HUGE |
Gene/Protein Characteristic Table for KIAA0425 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK07435 |
|---|---|
| Accession No. : | AB007885 |
| Description : | zinc finger protein 262. |
| HUGO Gene Name : | zinc finger, MYM-type 4 (ZMYM4) |
| Clone Name : | hh01272 [Vector Info] |
| Flexi ORF Clone : | pF1KA0425
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6108 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1270 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : TTCTGTGGTTTCTGTAAGGGG | |
| : AGTGTAGCTGTTGATGTGTGC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 12 |
| : GeneBridge 4 | |
| : TTCTGTGGTTTCTGTAAGGGG | |
| : AGTGTAGCTGTTGATGTGTGC | |
| : 95 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
