HUGE

Gene/Protein Characteristic Table for KIAA0429

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06061
Accession No. :	AB007889
Description :	Metastasis suppressor protein 1.
HUGO Gene Name :	metastasis suppressor 1 (MTSS1)
Clone Name :	hk07754 [Vector Info]
Source :	Human adult brain
Note :	We replaced hh01494, former representative clones for KIAA0429 with hk07754. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 4204 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2202 bp

Genome contig ID gi51511724r_125532212
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TTCAGCCTACGTTATAAATAAAGAACCACTAGATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAGTCCTGTATTTCAAGTCTTGTTACAATTCAGTTTGAGGTCTTAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 125632212 125672658 11 100.0 Terminal No-hit

Features of the protein sequence	Description

Length: 666 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001151047	8.9e-196	99.7	hypothetical pr...	Pan troglodytes
ABQ59025	9.9e-196	99.7	MTSS1 protein [...	Homo sapiens
CAH93514	4.9e-195	99.2	hypothetical pr...	Pongo abelii
XP_001150712	4.8e-191	99.7	metastasis supp...	Pan troglodytes
XP_001497568	4.9e-191	97.3	metastasis supp...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013606 1 173 PF08397 IRSp53/MIM homology domain (IMD)

IPR003124 638 655 PF02205 Actin-binding WH2

ProfileScan IPR003124 638 655 PS51082 Actin-binding WH2

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013606	1	173	PF08397	IRSp53/MIM homology domain (IMD)
IPR003124	638	655	PF02205	Actin-binding WH2
ProfileScan	IPR003124	638	655	PS51082	Actin-binding WH2

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: ACTGCACAGGGAGAGGTCAAC

Primer_r
: CCTTGGGTAGTTCTGCTTGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGTAGTGCCTGTGGTTTAGCC
Primer_r	: CTATTGTGATTACCTTGCAGC
PCR product length	: 81 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2202 bp
Genome contig ID	gi51511724r_125532212
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTCAGCCTACGTTATAAATAAAGAACCACTAGATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAGTCCTGTATTTCAAGTCTTGTTACAATTCAGTTTGAGGTCTTAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	125632212	125672658	11	100.0	Terminal No-hit

Primer_f	: ACTGCACAGGGAGAGGTCAAC
Primer_r	: CCTTGGGTAGTTCTGCTTGTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0429

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information