HUGE |
Gene/Protein Characteristic Table for KIAA0429 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06061 |
---|---|
Accession No. : | AB007889 |
Description : | Metastasis suppressor protein 1. |
HUGO Gene Name : | metastasis suppressor 1 (MTSS1) |
Clone Name : | hk07754 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hh01494, former representative clones for KIAA0429 with hk07754. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4204 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2202 bp Genome contig ID gi51511724r_125532212 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TTCAGCCTACGTTATAAATAAAGAACCACTAGATTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAAGTCCTGTATTTCAAGTCTTGTTACAATTCAGTTTGAGGTCTTAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 8 r 125632212 125672658 11 100.0 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 666 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: ACTGCACAGGGAGAGGTCAAC | |
: CCTTGGGTAGTTCTGCTTGTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 8 |
: GeneBridge 4 | |
: AGTAGTGCCTGTGGTTTAGCC | |
: CTATTGTGATTACCTTGCAGC | |
: 81 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |