HUGE |
Gene/Protein Characteristic Table for KIAA0432 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04510 |
---|---|
Accession No. : | AB007892 |
Description : | Cell division cycle 5-like protein. |
HUGO Gene Name : | |
Clone Name : | hh01859s1 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hh01859, former representative clones for KIAA0432 with hh01859s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6201 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3710 bp Genome contig ID gi89161210f_44363457 PolyA signal sequence
(ATTAAA,-23) +----*----+----*----+----*----+----
AAGCAACTTTAAATTAAAAAAATTGTTTTTAAAATFlanking genome sequence
(162684 - 162733) ----+----*----+----*----+----*----+----*----+----*
ATATTCTTCCTTTTATGTTTATTTAGTAAATTTAGGTAATGTATACTTTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 f 44463457 44526139 16 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 827 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GATAAAGCTGCCCAAAGAGAC | |
: CATCTCAAGTTCATCCTCATC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 18 |
: GeneBridge 4 | |
: GTGACTGCAGACTTAATGTTG | |
: CAATAGCCCAAAAGACCAATC | |
: 127 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |