HUGE

Gene/Protein Characteristic Table for KIAA0434

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04290
Accession No. :	AB007894
Description :	Protein bassoon.
HUGO Gene Name :
Clone Name :	hh02165 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5650 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 933 bp

Genome contig ID gi89161205f_49569058
PolyA signal sequence
(CATAAA,-27)
+----*----+----*----+----*----+----
GTATACCTCATAAACATTTTTCTTTTGTTTCTCTC
Flanking genome sequence
(111799 - 111848)
----+----*----+----*----+----*----+----*----+----*
TCCCCCTTTCTCTCTTCTCTTGGCTCACTCCCTTGCCTCTCCCCCTCCAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 49669058 49680855 8 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1571 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAA77176	100.0	Bassoon protein...	Homo sapiens
Q9UPA5	100.0	Protein bassoon...	Homo sapiens
NP_003449	99.9	bassoon protein...	Homo sapiens
AAC83555	99.9	neuronal double...	Homo sapiens
XP_516463	99.2	bassoon protein...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011131	1.7e-10	32.9	KIAA0559

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR008165 1454 1495 PD003992 Protein of unknown function GLTT

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR008165	1454	1495	PD003992	Protein of unknown function GLTT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CATCACAGGAGGAGAGGCAGC

Primer_r
: TTCCCGCTCTAGCTCCTCTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACGCTGCTTTTCGGTGCTATG
Primer_r	: CCGTTTCCTTCACATTCCAGC
PCR product length	: 187 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	933 bp
Genome contig ID	gi89161205f_49569058
PolyA signal sequence (CATAAA,-27)	+--------+--------+----*----+---- GTATACCTCATAAACATTTTTCTTTTGTTTCTCTC
Flanking genome sequence (111799 - 111848)	----+--------+--------+--------+--------+----* TCCCCCTTTCTCTCTTCTCTTGGCTCACTCCCTTGCCTCTCCCCCTCCAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	49669058	49680855	8	100.0	Perfect prediction

Primer_f	: CATCACAGGAGGAGAGGCAGC
Primer_r	: TTCCCGCTCTAGCTCCTCTTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0434

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information